Sequence 1002(DJ-M2 , DJM2)

Sequence DJ-M2 , DJM2
Target	PARK7 ( Homo sapiens )
Description	Parkinson disease ( autosomal recessive, early onset ) 7 Ensembl: ENSG00000116288 UniGene: Hs.419640 EntrezGene: 11315 Ensembl Chr1: 7944310 - 7967926 Strand: 1 GO terms: 0005515 0005634 0005737 0006457 0007265 0008344 0042542 0051585
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TGGAGACGGAGATCCCTGTTT / siRNA antisense (21b) ACAGGGATCTCCGTCTCCATT
Application	gene silencing
Name	DJ-M2 , DJM2

References

DJ-1 has a role in antioxidative stress to prevent cell death.Taira T, Saito Y, Niki T, Iguchi-Ariga SM, Takahashi K, Ariga H.EMBO Rep. 2004 Feb;5(2) :213-8. Epub 2004 Jan 23. EMBO Rep. 2004 Apr;5(4) :430.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Parkinson disease was first described by James Parkinson in 1817. It is the second most common neurodegenerative disorder after Alzheimer disease (AD; 104300), affecting approximately 1% of the population over age 50 (Polymeropoulos et al., 1996). Clinical Features. The diagnosis of classic idiopathic PD is primarily clinical, with manifestations including resting tremor, muscular rigidity, bradykinesia, and postural instability. Additional features are characteristic postural abnormalities, dysautonomia, dystonic cramps, and dementia. The disease is progressive and usually has an insidious onset in mid to late adulthood. Pathologic features of classic PD include by a loss of dopaminergic neurons in the substantia nigra (SN) and the presence of Lewy bodies, intracellular inclusions, in surviving neurons in various areas of the brain, particularly the SN (Nussbaum and Polymeropoulos, 1997). Autosomal recessive juvenile Parkinson disease (PARK2; 600116), however, does not have Lewy body pathology (Nussbaum and Polymeropoulos, 1997).

Many other diseases, both genetic and nongenetic, have parkinsonian motor features ('parkinsonism'), which most likely result from loss or dysfunction of the dopaminergic neurons in the SN, but may or may not have Lewy bodies on pathology. Thus, accurate diagnosis may be difficult without pathologic examination. Dementia with Lewy bodies (DLB; 127750) shows parkinsonism with Lewy bodies. However, parkinsonism without Lewy bodies characterizes progressive supranuclear palsy (PSP; 601104), frontotemporal dementia with parkinsonism (600274), autosomal dominant (128230) and recessive (605407) forms of Segawa syndrome, X-linked recessive Filipino type of dystonia (314250), multiple systems atrophy, and cerebrovascular disease. Other Features

Animal Model. Clarke et al. (2000) studied the kinetics of neuronal death in 12 models of photoreceptor degeneration, hippocampal neurons undergoing excitotoxic cell death, a mouse model of cerebellar degeneration, and in Parkinson and Huntington (143100) diseases. In all models the kinetics of neuronal death were exponential and better explained by mathematical models in which the risk of cell death remains constant or decreases exponentially with age. These kinetics argue against the cumulative damage hypothesis; instead, the time of death in any neuron is random. Clarke et al. (2000) argued that their findings are most simply accommodated by a '1-hit' biochemical model in which mutation imposes a mutant steady state on the neuron and a single event randomly initiates cell death. This model appears to be common to many forms of neurodegeneration and has implications for therapeutic strategies in that the likelihood that a mutant neuron can be rescued by treatment is not diminished by age, and therefore treatment at any stage of illness is likely to confer benefit.

Progressive postnatal depletion of dopaminergic cells has been demonstrated in weaver mice, a mouse model of Parkinson disease associated with homozygosity for a mutation in the H54 region of Girk2, a putative G protein inward rectifier protein potassium channel. Bandmann et al. (1996) found no mutations of the pore region in KCNJ6 (600877), the human homolog, in 50 cases of Parkinson disease, 23 of which were index cases of familial Parkinson disease.

Transgenic Drosophila expressing human alpha-synuclein carrying the ala30-to-pro (A30P; 163890.0002) mutation faithfully replicate essential features of human Parkinson disease, including age-dependent loss of dopaminergic neurons, Lewy body-like inclusions, and locomotor impairment. Scherzer et al. (2003) characterized expression of the entire Drosophila genome at presymptomatic, early, and advanced disease stages. Fifty-one signature transcripts were tightly associated with A30P alpha-synuclein expression. At the presymptomatic stage, expression changes revealed specific pathology. In age-matched transgenic Drosophila expressing the arg406-to-trp mutation in tau (157140.0003), the transcription of mutant alpha-synuclein-associated genes was normal, suggesting highly distinct pathways of neurodegeneration.

Landau et al. (2005) found that Fas (TNFRSF6; 134637)-deficient lymphoproliferative mice developed a PD phenotype, characterized by extensive nigrostriatal degeneration accompanied by tremor, hypokinesia, and loss of motor coordination, after treatment with MPTP at a dose that caused no phenotype in wildtype mice. Mice with mutated Fasl (TNFSF6; 134638) and generalized lymphoproliferative disease had an intermediate phenotype. Treatment of cultured midbrain neurons with Fasl to induce Fas signaling protected them from MPTP toxicity. Mice lacking only Fas exon 9, which encodes the death domain, but retaining the intracellular Fas domain and cell surface expression of Fas, were resistant to MPTP. Peripheral blood lymphocytes from patients with idiopathic PD showed a highly significant deficit in their ability to upregulate Fas after mitogen stimulation. Landau et al. (2005) concluded that reduced FAS expression increases susceptibility to neurodegeneration and that FAS has a role in neuroprotection.