Sequence 1004(si 126)
From Wikisequences
Sequence si_126 | |
---|---|
Target | PARP1 ( Homo sapiens ) |
Description | Poly (ADP-ribose) polymerase family, member 1
Ensembl: ENSG00000143799 UniGene: Hs.177766 EntrezGene: 142 Ensembl Chr1: 224615016 - 224662399 Strand: -1 GO terms: 0000723 0003677 0003950 0005515 0005622 0005634 0005635 0005730 0006281 0006284 0006366 0006471 0008270 0016068 0016757 0040009 0042802 0046872 0051287 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CAGGCUGCUUUGUCAAGAACA / siRNA antisense (21b) UUCUUGACAAAGCAGCCUGGA |
Application | gene silencing |
Name | si_126 |
References
DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478