Sequence 1011(a-parvin , aparvin)
| Sequence a-parvin , aparvin | |
|---|---|
| Target | PARVA ( Homo sapiens ) |
| Description | Parvin, alpha
Ensembl: ENSG00000197702 UniGene: Hs.607144 EntrezGene: 55742 Ensembl Chr11: 12355679 - 12508914 Strand: 1 GO terms: 0003779 0005515 0005634 0005737 0005856 0005925 0007155 0030027 0030054 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) TGAGGTGCGAACAATGGTGTT / siRNA antisense (21b) CACCATTGTTCGCACCTCATT |
| Application | gene silencing |
| Name | a-parvin , aparvin |
References
PINCH-1 is an obligate partner of integrin-linked kinase (ILK)functioning in cell shape modulation, motility, and survival.Fukuda T, Chen K, Shi X, Wu C.J Biol Chem. 2003 Dec 19;278(51) :51324-33. Epub 2003 Oct 8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. Members of the parvin family, including PARVA, are actin-binding proteins associated with focal contacts.Gene Function. Olski et al. (2001) determined that recombinant mouse Parva bound muscle F-actin with a dissociation constant similar to those of other actin-binding proteins. By domain analysis, they determined that the second calponin homology domain of Parva was sufficient for targeting to focal contacts. Animal Model.Lange et al. (2009) showed that mice carrying point mutations in the proposed autophosphorylation site of the putative kinase domain and in the pleckstrin homology domain are normal.
In contrast, mice with point mutations in the conserved lysine residue of the potential ATP-binding site of the kinase domain, which mediates Ilk binding to alpha-parvin, die owing to renal agenesis. Similar renal defects occur in alpha-parvin-null mice. Lange et al. (2009) concluded that their results provided genetic evidence that the kinase activity of Ilk is dispensable for mammalian development; however, an interaction between Ilk and alpha-parvin is critical for kidney development.
Lange et al. (2009) found that mice with mutations at a residue in integrin-linked kinase (Ilk; 602366) that is required for binding to alpha-parvin die owing to renal agenesis. Similar renal defects occur in alpha-parvin-null mice (Montanez et al., 2009). Lange et al. (2009) concluded that an interaction between Ilk and alpha-parvin is critical for kidney development.
