Sequence 1012(PB1-6 , PB16)

From Wikisequences
Jump to: navigation, search
Sequence PB1-6 , PB16
Target PB1 gene ( AY790295.1 ) ( Influenza A virus (A / swine / Korea / S175 / 2004( H1N1 ))
Description
Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GCAGGCAAACCATTTGAATTT / siRNA antisense (21b) ATTCAAATGGTTTGCCTGCTT
Application gene silencing
Name PB1-6 , PB16

References

RNA interference of influenza virus production by directly targeting mRNA for degradation and indirectly inhibiting all viral RNA transcription.Ge Q, McManus MT, Nguyen T, Shen CH, Sharp PA, Eisen HN, Chen J.Proc Natl Acad Sci U S A. 2003 Mar 4;100(5) :2718-23. Epub 2003 Feb 19. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders