Sequence 1016(PB1-2257 , PB12257)
From Wikisequences
| Sequence PB1-2257 , PB12257 | |
|---|---|
| Target | polymerase subunit PB1 (PB1) gene ( AY619955.1 ) (Influenza A virus (A / swine / Saskatchewan / 18789 / 02( H1N1 )) |
| Description | |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GATCTGTTCCACCATTGAATT / siRNA antisense (21b) TTCAATGGTGGAACAGATCTT |
| Application | gene silencing |
| Name | PB1-2257 , PB12257 |
References
RNA interference of influenza virus production by directly targeting mRNA for degradation and indirectly inhibiting all viral RNA transcription.Ge Q, McManus MT, Nguyen T, Shen CH, Sharp PA, Eisen HN, Chen J.Proc Natl Acad Sci U S A. 2003 Mar 4;100(5) :2718-23. Epub 2003 Feb 19.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
