Sequence 1017(siPIK3C2A.1)

From Wikisequences
Jump to: navigation, search
Sequence siPIK3C2A.1
Target PIK3C2A (Homo sapiens)
Description Phosphoinositide-3-kinase, class 2, alpha polypeptide

Ensembl: ENSG00000011405

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) CCCACTAATTGCATTGGAATT / siRNA antisense (21b) TTCCAATGCAATTAGTGGGTA
Application gene silencing
Name siPIK3C2A.1

References

Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders