Sequence 1018(mcPLA2)
From Wikisequences
Sequence mcPLA2 | |
---|---|
Target | Pla2g4a ( Mus musculus ) |
Description | Phospholipase A2, group IVA ( cytosolic, calcium-dependent )
Ensembl: ENSMUSG00000056220 UniGene: Mm.4186 EntrezGene: 18783 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ACCCTAGGCACAGCTACATTT / siRNA antisense (21b) ATGTAGCTGTGCCTAGGGTTT |
Application | gene silencing |
Name | mcPLA2 |
References
Ceramide 1-phosphate is a direct activator of cytosolic phospholipase A2.Pettus BJ, Bielawska A, Subramanian P, Wijesinghe DS, Maceyka M, Leslie CC, Evans JH, Freiberg J, Roddy P, Hannun YA, Chalfant CE.J Biol Chem. 2004 Mar 19;279(12) :11320-6. Epub 2003 Dec 15.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
