Sequence 1018(mcPLA2)

From Wikisequences
Jump to: navigation, search
Sequence mcPLA2
Target Pla2g4a ( Mus musculus )
Description Phospholipase A2, group IVA ( cytosolic, calcium-dependent )

Ensembl: ENSMUSG00000056220 UniGene: Mm.4186 EntrezGene: 18783

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) ACCCTAGGCACAGCTACATTT / siRNA antisense (21b) ATGTAGCTGTGCCTAGGGTTT
Application gene silencing
Name mcPLA2

References

Ceramide 1-phosphate is a direct activator of cytosolic phospholipase A2.Pettus BJ, Bielawska A, Subramanian P, Wijesinghe DS, Maceyka M, Leslie CC, Evans JH, Freiberg J, Roddy P, Hannun YA, Chalfant CE.J Biol Chem. 2004 Mar 19;279(12) :11320-6. Epub 2003 Dec 15. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders