Sequence 1019(hcPLA2)

Sequence hcPLA2
Target	PLA2G4A ( Homo sapiens )
Description	Phospholipase A2, group IVA ( cytosolic, calcium-dependent ) Ensembl: ENSG00000116711 UniGene: Hs.497200 EntrezGene: 5321 Ensembl Chr1: 185064655 - 185224726 Strand: 1 GO terms: 0000287 0004289 0004427 0004620 0004622 0004623 0005509 0005737 0005829 0006508 0006663 0006690 0006796 0009395 0016021 0016042 0016787 0031410
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GTTTACGGTAGTGGTGTTATT / siRNA antisense (21b) TAACACCACTACCGTAAACTT
Application	gene silencing
Name	hcPLA2

References

Ceramide 1-phosphate is a direct activator of cytosolic phospholipase A2.Pettus BJ, Bielawska A, Subramanian P, Wijesinghe DS, Maceyka M, Leslie CC, Evans JH, Freiberg J, Roddy P, Hannun YA, Chalfant CE.J Biol Chem. 2004 Mar 19;279(12) :11320-6. Epub 2003 Dec 15.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Cytosolic phospholipase A2 (PLA2; EC 3.1.1.4) catalyzes the release of arachidonic acid from membrane phospholipids. Arachidonic acid in turn serves as precursor for a wide spectrum of biologic effectors, collectively known as eicosanoids, that are involved in hemodynamic regulation, inflammatory responses, and other cellular processes (summary by Tay et al., 1995). (Eicosanoids are lipid mediators of inflammation; they include a variety of compounds (prostaglandins, thromboxanes, leukotrienes, hydroxy- and epoxy-fatty acids, lipoxins, and isoprostanes) that are derived from the ubiquitous 20-carbon atom arachidonate (20 in Greek is 'eicosa') and a few similar polyunsaturated fatty acids (summary by De Caterina and Zampolli, 2004).) Gene Function. By site-directed mutagenesis and biochemical analysis of the recombinant protein, Sharp et al. (1994) determined that ser228 participates in the catalytic mechanism of cPLA2 and that both the phospholipase A2 and the lysophospholipase activities are catalyzed by the same active site residue(s).

PLA2G4A, the cytosolic phospholipase A2, appears to subserve transmembrane signaling responses to extracellular ligands (Skorecki, 1995). Sheridan et al. (2001) found that cPLA2 interacts with both splice variants of HTATIP (601409), a protein that was originally isolated as an HIV-1 TAT-interactive protein. In transfection experiments, they found that cPLA2 and HTATIP coimmunoprecipitate and colocalize. Using serum withdrawal to induce growth arrest and apoptosis in mouse renal mesangial cells, Sheridan et al. (2001) found cytosolic to nuclear translocation of endogenous complexes correlated with onset of apoptosis. CPLA2 and HITATIP synergistically induced arachidonic acid production following serum withdrawal.

Animal Model. Haq et al. (2003) generated mice deficient in PLA2G4A by targeted disruption. Heart size was larger in knockout mice compared to wildtype littermates, and both heart and skeletal myocyte cross-sectional area were significantly greater in knockout mice. Haq et al. (2003) found that cytosolic PLA2, the protein product of the PLA2G4A gene, is a negative regulator of growth, specifically of striated muscle. They showed that normal growth of skeletal muscle, as well as normal and pathologic stress-induced hypertrophic growth of the heart, were exaggerated in Pla2g4a -/- mice. The mechanism underlying this phenotype is that cytosolic PLA2 negatively regulates insulin-like growth factor-1 (IGF1; 147440) signaling. Absence of cytosolic PLA2 leads to sustained activation of the IGF1 pathway, which results from the failure of 3-phosphoinositide-dependent protein kinase-1 (PDK1; 605213) to recruit and phosphorylate protein kinase C-zeta (176982), the negative regulator of IGF1 signaling. Arachidonic acid restores activation of PKC-zeta, correcting the exaggerated IGF1 signaling. Haq et al. (2003) concluded that cytosolic PLA2 and arachidonic acid regulate striated muscle growth by modulating multiple growth-regulatory pathways.

Ichinose et al. (2002) found that Pla2g4a-null mice were less able than wildtype mice to maintain systemic oxygenation during left main stem bronchus occlusion, and they did not increase pulmonary vascular resistance during occlusion, as did wildtype mice. Inhibition of cyclooxygenase or nitric oxide synthase, as well as breathing 10% oxygen for 3 weeks, restored hypoxic pulmonary vasoconstriction in mutant mice. Ichinose et al. (2002) concluded that Pla2g4a contributes to the murine pulmonary vasoconstrictor response to hypoxia and that augmenting pulmonary vascular tone restores vasoconstriction in the absence of Pla2g4a activity.

Hegen et al. (2003) generated cPla2-alpha -/- mice on a DBA/1LacJ background susceptible to collagen-induced arthritis (CIA), a mouse model of rheumatoid arthritis (180300). The mutant mice were much less likely to develop CIA than wildtype mice, although there was no difference in their anti-collagen antibody levels. Hegen et al. (2003) concluded that cPLA2-alpha plays a critical role in CIA pathogenesis.

After contusive spinal cord injury in rats, Liu et al. (2006) found increased overall Pla2 activity and markedly increased cytosolic Pla2 expression (6- to 7-fold) mainly within neurons and oligodendrocytes of the spinal cord. In vitro, endogenous Pla2 induced spinal cord neuronal death, which was reversed by the Pla2 inhibitor mepacrine. Microinjection of Pla2 into spinal cord in vivo resulted in confined demyelination and later diffuse tissue necrosis, as well as increased inflammation, oxidation, and tissue damage with corresponding electrophysiologic and behavioral impairment. Liu et al. (2006) suggested that Pla2 may be a converging molecule that mediates pathogenesis of multiple injury pathways in spinal cord injury and that blocking its action may reduce tissue damage.