Sequence 1020(Perilipin)

From Wikisequences
Jump to: navigation, search
Sequence Perilipin
Target PLIN1 ( Homo sapiens )
Description Perilipin

Ensembl: ENSG00000166819 UniGene: Hs.103253 , Hs.697349 EntrezGene: 5346 Ensembl Chr15: 88008607 - 88023595 Strand: -1 GO terms: 0005515 0005811 0008289 0016042

Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) GCCATGTCCCTATCAGATGC / Reverse PCR primer (20b) GTTGTCGATGTCCCGGAATT
Application gene expression
Name Perilipin

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders