Sequence 1020(Perilipin)
From Wikisequences
| Sequence Perilipin | |
|---|---|
| Target | PLIN1 ( Homo sapiens ) |
| Description | Perilipin
Ensembl: ENSG00000166819 UniGene: Hs.103253 , Hs.697349 EntrezGene: 5346 Ensembl Chr15: 88008607 - 88023595 Strand: -1 GO terms: 0005515 0005811 0008289 0016042 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) GCCATGTCCCTATCAGATGC / Reverse PCR primer (20b) GTTGTCGATGTCCCGGAATT |
| Application | gene expression |
| Name | Perilipin |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
