Sequence 1022(TIP47)

From Wikisequences
Jump to: navigation, search
Sequence TIP47
Target PLIN3 ( Homo sapiens )
Description Mannose-6-phosphate receptor binding protein 1

Ensembl: ENSG00000105355 UniGene: Hs.140452 EntrezGene: 10226 Ensembl Chr19: 4789346 - 4818676 Strand: -1 GO terms: 0005737 0005768 0005794 0016020 0016192

Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) GCTGGACAAGTTGGAGGAGA / Reverse PCR primer (20b) CCGACACCTTAGACGACACA
Application gene expression
Name TIP47

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders