Sequence 1022(TIP47)
From Wikisequences
| Sequence TIP47 | |
|---|---|
| Target | PLIN3 ( Homo sapiens ) |
| Description | Mannose-6-phosphate receptor binding protein 1
Ensembl: ENSG00000105355 UniGene: Hs.140452 EntrezGene: 10226 Ensembl Chr19: 4789346 - 4818676 Strand: -1 GO terms: 0005737 0005768 0005794 0016020 0016192 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) GCTGGACAAGTTGGAGGAGA / Reverse PCR primer (20b) CCGACACCTTAGACGACACA |
| Application | gene expression |
| Name | TIP47 |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
