Sequence 1023(S3-12)

From Wikisequences
Jump to: navigation, search
Sequence S3-12
Target PLIN4 ( Homo sapiens )
Description Perilipin 4

Ensembl: ENSG00000167676 UniGene: Hs.591387 EntrezGene: 29393 Ensembl Chr19: 4455471 - 4464704 Strand: -1 GO terms: 0005515 0005524 0005886 0044267

Design primer set
Chemistry DNA
Sequence Forward PCR primer (21b) ACATCTTCCACCCCATGAATG / Reverse PCR primer (18b) GTGTTCAAATGCCCGCTG
Application gene expression
Name S3-12

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders