Sequence 1023(S3-12)

Sequence S3-12
Target	PLIN4 ( Homo sapiens )
Description	Perilipin 4 Ensembl: ENSG00000167676 UniGene: Hs.591387 EntrezGene: 29393 Ensembl Chr19: 4455471 - 4464704 Strand: -1 GO terms: 0005515 0005524 0005886 0044267
Design	primer set
Chemistry	DNA
Sequence	Forward PCR primer (21b) ACATCTTCCACCCCATGAATG / Reverse PCR primer (18b) GTGTTCAAATGCCCGCTG
Application	gene expression
Name	S3-12

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background