Sequence 1023(S3-12)
From Wikisequences
Sequence S3-12 | |
---|---|
Target | PLIN4 ( Homo sapiens ) |
Description | Perilipin 4
Ensembl: ENSG00000167676 UniGene: Hs.591387 EntrezGene: 29393 Ensembl Chr19: 4455471 - 4464704 Strand: -1 GO terms: 0005515 0005524 0005886 0044267 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (21b) ACATCTTCCACCCCATGAATG / Reverse PCR primer (18b) GTGTTCAAATGCCCGCTG |
Application | gene expression |
Name | S3-12 |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478