Sequence 1026(siPlk1-3 , siPlk13)

Sequence siPlk1-3 , siPlk13
Target	PLK1 ( Homo sapiens )
Description	Polo-like kinase 1 ( Drosophila ) Ensembl: ENSG00000166851 UniGene: Hs.592049 EntrezGene: 5347 Ensembl Chr16: 23597702 - 23609189 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005634 0005813 0006468 0006813 0007067 0008283 0015272 0016020 0016740
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CCAAAGTCGAATATGACGGTT / siRNA antisense (21b) CCGTCATATTCGACTTTGGTT
Application	gene silencing
Name	siPlk1-3 , siPlk13

References

Specificity of short interfering RNA determined through gene expression signatures.Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.Proc Natl Acad Sci U S A. 2003 May 27;100(11) :6347-52. Epub 2003 May 13.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Golsteyn et al. (1995) expressed recombinant human PLK1 in insect cells and found that it phosphorylated casein (see 115450) on serine and threonine residues. PLK1 also phosphorylated myelin basic protein (MBP; 159430) and microtubule-associated protein-2 (MAP2; 157130), but to a lesser extent than casein. In synchronized HeLa cells, PLK1 activity was low during interphase and high during mitosis. Confocal microscopy showed that PLK1 bound components of the mitotic spindle at all stages of mitosis, but it was redistributed as cells progressed from metaphase to anaphase. Specifically, PLK1 associated with spindle poles up to metaphase, but it relocalized to the equatorial plane, where spindle microtubules overlapped, as cells went through anaphase. Golsteyn et al. (1995) concluded that PLK1 functions in mitotic cells to control spindle dynamics and chromosome segregation.

Smith et al. (1997) showed that microinjection of PLK mRNA induced mitosis in quiescent NIH 3T3 cells. Constitutive expression of PLK caused NIH 3T3 cells to proliferate in low serum media, but at a lower rate than cells transformed with v-Ras (179555) or v-Src (190090). Cells transformed with PLK grew in soft agar and produced tumors in nude mice. Smith et al. (1997) concluded that PLK may be involved in the promotion or progression of cancers.

In vertebrate cells, nuclear entry of mitosis-promoting factor (MPF; see cyclin B1, 123836) during prophase is thought to be essential for induction and coordination of M-phase events. Phosphorylation of cyclin B1 is central to its nuclear translocation. Toyoshima-Morimoto et al. (2001) purified a protein kinase from Xenopus M-phase extracts that phosphorylated a crucial serine (S147) in the middle of the nuclear export signal of cyclin B1. They identified this kinase as Plx1, a Xenopus homolog of PLK1. During cell cycle progression in HeLa cells, a change in the kinase activity of endogenous PLK1 toward S147 and/or S133 correlated with kinase activity in the cell extracts. An anti-PLK1 antibody depleted the M-phase extracts of the kinase activity toward S147 and/or S133. An anti-phospho-S147 antibody reacted specifically with cyclin B1 only during G2/M phase. A mutant cyclin B1 in which S133 and S147 were replaced by alanines remained in the cytoplasm, whereas wildtype cyclin B1 accumulated in the nucleus during prophase. Coexpression of constitutively active PLK1 stimulated nuclear entry of cyclin B1. Toyoshima-Morimoto et al. (2001) concluded that PLK1 may be involved in targeting MPF to the nucleus during prophase.

Elia et al. (2003) used a proteomic screen to identify the polo-box domain of PLK1 as a specific phosphoserine or phosphothreonine binding domain and determined its optimal binding motif. This motif is present in PLK1 substrates such as CDC25 (157680), and an optimal phosphopeptide containing the motif disrupted polo-box domain-substrate binding and localization of the polo-box domain to centrosomes. Elia et al. (2003) concluded that their observations revealed how PLK1 can localize to specific sites within cells in response to CDK phosphorylation at those sites and provided a structural mechanism for targeting the PLK1 kinase domain to its substrates.

Meiosis is a specialized cell division in which 2 chromosome segregation phases follow a single DNA replication phase. Lee and Amon (2003) studied the S. cerevisiae Polo-like kinase CDC5, whose human homolog is PLK, and found it to be instrumental in establishing the meiosis I chromosome segregation program. CDC5 was required to phosphorylate and remove meiotic cohesin from chromosomes. Furthermore, in the absence of CDC5, kinetochores were bioriented during meiosis I, and Mam1, a yeast protein essential for coorientation, failed to associate with kinetochores. Thus, sister-kinetochore coorientation and chromosome segregation during meiosis I are coupled through their dependence upon CDC5. Animal Model.To identify the source of newly formed cardiomyocytes during zebrafish heart regeneration, Jopling et al. (2010) established a genetic strategy to trace the lineage of cardiomyocytes in the adult fish, on the basis of the Cre/lox system widely used in the mouse. They used this system to show that regenerated heart muscle cells are derived from the proliferation of differentiated cardiomyocytes. Furthermore, the proliferating cardiomyocytes undergo limited dedifferentiation characterized by the disassembly of their sarcomeric structure, detachment from one another, and the expression of regulators of cell-cycle progression. Specifically, Jopling et al. (2010) showed that the gene product of polo-like kinase 1 (plk1) is an essential component of cardiomyocyte proliferation during heart regeneration. Jopling et al. (2010) concluded that their data provided the first direct evidence for the source of proliferating cardiomyocytes during zebrafish heart regeneration and indicated that stem or progenitor cells are not significantly involved in this process.