Sequence 1031(hA1-5 , hA15)
| Sequence hA1-5 , hA15 | |
|---|---|
| Target | Polb ( Mus musculus ) |
| Description | Polymerase ( DNA directed ), beta
Ensembl: ENSMUSG00000031536 UniGene: Mm.123211 EntrezGene: 18970 Ensembl Chr8: 23738604 - 23763897 Strand: -1 GO terms: 0000287 0000795 0003677 0003684 0003824 0003887 0003890 0003912 0005622 0005634 0005737 0005876 0006260 0006281 0006287 0006290 0006916 0008017 0008219 0016740 0016829 0017125 0031402 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) ATCATGACTGACCGAGGCATT / siRNA antisense (21b) TGCCTCGGTCAGTCATGATTT |
| Application | gene silencing |
| Name | hA1-5 , hA15 |
References
Targeting heterogeneous nuclear ribonucleoparticule A1 and A2 proteins by RNA interference promotes cell death in transformed but not in normal mouse cell lines.Patry C, Lemieux B, Wellinger RJ, Chabot B.Mol Cancer Ther. 2004 Oct;3(10) :1193-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
