Sequence 1034(pol beta 3 , polbeta3)
From Wikisequences
Sequence pol_beta_3 , polbeta3 | |
---|---|
Target | Polb ( Mus musculus ) |
Description | Polymerase ( DNA directed ), beta
Ensembl: ENSMUSG00000031536 UniGene: Mm.123211 EntrezGene: 18970 Ensembl Chr8: 23738604 - 23763897 Strand: -1 GO terms: 0000287 0000795 0003677 0003684 0003824 0003887 0003890 0003912 0005622 0005634 0005737 0005876 0006260 0006281 0006287 0006290 0006916 0008017 0008219 0016740 0016829 0017125 0031402 |
Design | shRNA |
Chemistry | RNA |
Sequence | (64b) TCGAGCCTCAATGAGTACACCATCCGTTCAAGAGACGGATGGTGTACTCATTGATTTTTGGAAA |
Application | gene silencing |
Name | pol_beta_3 , polbeta3 |
References
Knock down' of DNA polymerase beta by RNA interference: recapitulation of null phenotype.Polosina YY, Rosenquist TA, Grollman AP, Miller H.DNA Repair (Amst) . 2004 Nov 2;3(11) :1469-74.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478