Sequence 1035(LSDP5)

From Wikisequences
Jump to: navigation, search
Sequence LSDP5
Target PPARG ( Homo sapiens )
Description Peroxisome proliferator-activated receptor gamma

Ensembl: ENSG00000132170 UniGene: Hs.162646 EntrezGene: 5468 Ensembl Chr3: 12304070 - 12450855 Strand: 1 GO terms: 0000122 0003677 0003700 0003707 0004872 0004879 0005515 0005634 0005829 0006091 0006350 0006355 0006629 0007165 0007584 0008270 0016563 0016564 0030855 0043565 0045165 0045600 0045941

Design primer set
Chemistry DNA
Sequence Forward PCR primer (21b) AGCACGATGTCTGAAGAAGAG / Reverse PCR primer (20b) TCCTTGGCTGCACTGTAAAC
Application gene expression
Name LSDP5

References

Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders