Sequence 1037(CypB)

From Wikisequences
Jump to: navigation, search
Sequence CypB
Target PPIB ( Homo sapiens )
Description Peptidylprolyl isomerase B ( cyclophilin B )

Ensembl: ENSG00000166794 UniGene: Hs.434937 EntrezGene: 5479

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GGTGGAGAGCACCAAGACATT / siRNA antisense (21b) TGTCTTGGTGCTCTCCACCTT
Application gene silencing
Name CypB

References

Role of cyclophilin B in activation of interferon regulatory factor-3.Obata Y, Yamamoto K, Miyazaki M, Shimotohno K, Kohno S, Matsuyama T.J Biol Chem. 2005 May 6;280(18) :18355-60. Epub 2005 Mar 10. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders