Sequence 1037(CypB)
From Wikisequences
Sequence CypB | |
---|---|
Target | PPIB ( Homo sapiens ) |
Description | Peptidylprolyl isomerase B ( cyclophilin B )
Ensembl: ENSG00000166794 UniGene: Hs.434937 EntrezGene: 5479 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGTGGAGAGCACCAAGACATT / siRNA antisense (21b) TGTCTTGGTGCTCTCCACCTT |
Application | gene silencing |
Name | CypB |
References
Role of cyclophilin B in activation of interferon regulatory factor-3.Obata Y, Yamamoto K, Miyazaki M, Shimotohno K, Kohno S, Matsuyama T.J Biol Chem. 2005 May 6;280(18) :18355-60. Epub 2005 Mar 10.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
