Sequence 1038(PRDM2i-1853 , PRDM2i1853)
From Wikisequences
| Sequence PRDM2i-1853 , PRDM2i1853 | |
|---|---|
| Target | PRDM2 ( Homo sapiens ) |
| Description | PR domain containing 2, with ZNF domain
Ensembl: ENSG00000116731 UniGene: Hs.371823 EntrezGene: 7799 Ensembl Chr1: 13899322 - 14024162 Strand: 1 GO terms: 0003676 0003677 0003700 0005622 0005634 0006355 0008270 0030528 0045449 0046872 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GACTGCTCAGAGGTAACACTT / siRNA antisense (21b) GTGTTACCTCTGAGCAGTCTT |
| Application | gene silencing |
| Name | PRDM2i-1853 , PRDM2i1853 |
References
Iterative microarray and RNA interference-based interrogation of the SRC-induced invasive phenotype.Irby RB, Malek RL, Bloom G, Tsai J, Letwin N, Frank BC, Verratti K, Yeatman TJ, Lee NH.Cancer Res. 2005 Mar 1;65(5) :1814-21.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
