Sequence 1039(PKACa)

From Wikisequences
Jump to: navigation, search
Sequence PKACa
Target Prkaca ( Mus musculus )
Description Protein kinase, cAMP-dependent, catalytic, alpha

Ensembl: ENSG00000072062 UniGene: Hs.631630 EntrezGene: 5566 Ensembl Chr19: 14063509 - 14089559 Strand: -1 GO terms: 0000166 0004672 0004674 0004691 0004713 0005515 0005524 0005634 0005737 0005952 0006468 0016740

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GTGGTTTGCCACGACTGACTT / siRNA antisense (21b) GTCAGTCGTGGCAAACCACTT
Application gene silencing
Name PKACa

References

Protein kinase A blocks Raf-1 activity by stimulating 14-3-3 binding and blocking Raf-1 interaction with Ras.Dumaz N, Marais R.J Biol Chem. 2003 Aug 8;278(32) :29819-23. Epub 2003 Jun 11. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Description. Most of the effects of cAMP in the eukaryotic cell are mediated through the phosphorylation of target proteins on serine or threonine residues by the cAMP-dependent protein kinase (EC 2.7.1.37). The inactive cAMP-dependent protein kinase is a tetramer composed of 2 regulatory and 2 catalytic subunits. The cooperative binding of 4 molecules of cAMP dissociates the enzyme in a regulatory subunit dimer and 2 free active catalytic subunits. In the human, 4 different regulatory subunits (PRKAR1A, 188830; PRKAR1B, 176911; PRKAR2A, 176910; and PRKAR2B, 176912) and 3 catalytic subunits (PRKACA; PRKACB, 176892; and PRKACG 176893) have been identified (summary by Tasken et al., 1996). Gene Function. Studying hippocampal slices from rats of different ages, Yasuda et al. (2003) found that protein kinase A is required for long-term potentiation (LTP) in neonatal tissue (less than 9 postnatal days). After that time, LTP requires calcium/calmodulin-dependent protein kinase II (see CAMK2A, 114078). Yasuda et al. (2003) suggested that developmental changes in synapse morphology, including a shift from dendritic shafts to dendritic spines and compartmentalization of calcium, may underlie the changes in kinase activity. Animal Model.The intracellular second messenger cAMP affects cell physiology by directly interacting with effector molecules that include cyclic nucleotide-gated ion channels, cAMP-regulated G protein exchange factors, and cAMP-dependent protein kinases (PKA). Two catalytic subunits, C-alpha (PRKACA) and C-beta (PRKACB), are expressed in the mouse and mediate the effects of PKA. Skalhegg et al. (2002) generated a null mutation in the major catalytic subunit of PKA, C-alpha, and observed early postnatal lethality in the majority of C-alpha knockout mice. Surprisingly, a small percentage of C-alpha knockout mice, although runted, survived to adulthood. This growth retardation was not due to decreased GH (139250) production but did correlate with a reduction in IGF1 (147440) mRNA in the liver and diminished production of the major urinary proteins in kidney. In these animals, compensatory increases in C-beta levels occurred in brain whereas many tissues, including skeletal muscle, heart, and sperm, contained less than 10% of the normal PKA activity. Analysis of sperm in C-alpha knockout males revealed that spermatogenesis progressed normally but that mature sperm had defective forward motility.

Support Doctors Without Borders