Sequence 1042(PKCd)

Sequence PKCd
Target	Prkcd ( Mus musculus )
Description	Protein kinase C, delta Ensembl: ENSG00000163932 UniGene: Hs.155342 EntrezGene: 5580 Ensembl Chr3: 53170263 - 53201771 Strand: 1 GO terms: 0000166 0004672 0004674 0004701 0004713 0005524 0005634 0005737 0006468 0006917 0007242 0008022 0008047 0008270 0016020 0016064 0016301 0016740 0019899 0019992 0032613 0032615 0042100
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) AGTACTTGGCAAAGGCAGCTT / siRNA antisense (21b) GCTGCCTTTGCCAAGTACTTT
Application	gene silencing
Name	PKCd

References

Epidermal growth factor induces fibroblast contractility and motility via a protein kinase C delta-dependent pathway.Iwabu A, Smith K, Allen FD, Lauffenburger DA, Wells A.J Biol Chem. 2004 Apr 9;279(15) :14551-60. Epub 2004 Jan 27.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The PRKCD gene encodes a member of the protein kinase C family, members of which are critical for regulation of cell survival, proliferation, and apoptosis. In B lymphocytes, PRKCD is involved in B-cell receptor-mediated signaling (summary by Salzer et al., 2013). Gene Function. Aris et al. (1993) found that PKC-delta underwent calcium-independent autophosphorylation in the presence of phosphatidylserine and diacylglycerol. Diacylglycerol was an absolute requirement for PKC-delta activation. This and other cofactor and substrate requirements distinguished human PKC-delta from its mouse homolog.

Liu et al. (2006) showed that preexisting nuclear RELA (164014), which is an NFKB subunit, positively regulates ultraviolet (UV) irradiation-induced activation of JNK (MAPK8; 601158). In UV-irradiated mouse fibroblasts, they found that Pkc-delta was required for Rela to activate Jnk, thereby contributing to UV-induced apoptosis.

Tu et al. (2007) showed that Wnt3a (606359) signaling induced osteoblastogenesis in a mouse stromal bone marrow cell line, ST2, through G-alpha-q (GNAQ; 600998) and G-alpha-11 (GNA11; 139313), leading to activated phosphatidylinositol signaling and Prkcd. Wnt7b (601967), expressed by osteogenic cells in vivo, induced osteoblast differentiation in ST2 and mouse mesenchymal cells via the Prkcd-mediated pathway. Tu et al. (2007) concluded that PRKCD is part of a noncanonical WNT signaling cascade.

In a cultured bovine retinal pericyte model, Geraldes et al. (2009) demonstrated that hyperglycemia persistently activates PRKCD and p38-alpha MAPK (MAPK14; 600289), thus increasing expression of SHP1 (PTPN6; 176883), and that this occurs independently of NFKB (see 164011) activation. This signaling cascade leads to PDGF receptor-beta (PDGFRB; 173410) dephosphorylation and a reduction in downstream signaling from this receptor, resulting in pericyte apoptosis, the most specific vascular histopathology associated with diabetic complications. The authors observed increased PRKCD activity and an increase in the number of acellular capillaries in diabetic mouse retinas, which were not reversible with insulin treatment that achieved normoglycemia. Unlike diabetic age-matched wildtype mice, diabetic Prkcd -/- mice did not show activation of MAPK14 or SHP1, inhibition of PDGFB (190040) signaling in vascular cells, or the presence of acellular capillaries. The authors also observed PRKCD, MAPK14, and SHP1 activation in brain pericytes and in the renal cortex of diabetic mice. Geraldes et al. (2009) concluded that this represents a new signaling pathway by which hyperglycemia can induce PDGFB resistance and increased vascular cell apoptosis to cause diabetic vascular complications.

Haubensak et al. (2010) used molecular genetic approaches to map the functional connectivity of a subpopulation of GABA-containing neurons located in the lateral subdivision of the central amygdala (CEl), which express PRKCD. Channelrhodopsin-2-assisted circuit mapping in amygdala slices and cell-specific viral tracing indicated that PRKCD-positive neurons inhibit output neurons in the medial central amygdala (CEm), and also make reciprocal inhibitory synapses with PRKCD-negative neurons in CEl. Electrical silencing of PRKCD-positive neurons in vivo suggested that they correspond to physiologically identified units that are inhibited by the conditioned stimulus, called CEl(off) units. Haubensak et al. (2010) concluded that this correspondence, together with behavioral data, defines an inhibitory microcircuit in CEl that gates CEm output to control the level of conditioned freezing. Animal Model.PRKCD is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Prkcd is most abundant in B and T lymphocytes of lymphoid organs, cerebrum, and intestine of normal mice. By generating mice with a disruption in the Prkcd gene, Miyamoto et al. (2002) observed that the mice are viable up to 1 year but prone to autoimmune disease, with enlarged lymph nodes and spleens containing numerous germinal centers. Flow cytometric analysis showed increased numbers of bone marrow-derived B cells, but no change in CD5+ B cells or T cells. Transfer of B cells into Rag1 (179615) -/- mice resulted in greater numbers of splenic B cells and germinal centers in mice receiving Prkcd -/- cells. Prkcd-deficient B cells also mounted a stronger proliferative response than those from wildtype mice. RT-PCR analysis detected higher levels of IL6 (147620), but not other cytokines, in mutant than in wildtype B cells. EMSA analysis showed increased DNA-binding activity of NFIL6 (CEBPB; 189965) but not NFKB. Serum IgG1 and IgA, but not other isotype, concentrations were greater in Prkcd-deficient mice. Although Miyamoto et al. (2002) did not detect antinuclear antibodies, they did observe high levels of primarily IgG antibodies to chromatin in older mutant mice. Histologic analysis revealed evidence of glomerulonephritis with deposition of IgG and complement component C3. Miyamoto et al. (2002) noted that crosslinking of B cell receptors leads to activation of both Prkcb (176970) and Prkcd, but that proliferation in mice deficient in these enzymes is reduced and enhanced, respectively, possibly allowing for fine regulation of the immune response.

Mecklenbrauker et al. (2002) generated mice with a null mutation in Prkcd. They found that this deficiency prevents B cell tolerance and allows maturation and terminal differentiation of self-reactive B cells in the presence of a tolerizing antigen, soluble hen egg lysozyme. The authors detected high levels of serum anti-DNA antibodies as well as polyreactive antibodies to antigens without previous immunization. They concluded that although Prkcd deficiency does not affect B cell receptor-mediated activation in response to immunogens, induction of tolerance is compromised in the mutant mice.

Using a mouse model, Mecklenbrauker et al. (2004) reported a mechanism for the regulation of peripheral B-cell survival by serine/threonine protein kinase C-delta: spontaneous death of resting B cells is regulated by nuclear localization of Pkcd that contributes to phosphorylation of histone H2B (see 609904) at serine-14. Treatment of B cells with the potent B-cell survival factor Baff (603969) prevented nuclear accumulation of Pkcd. Mecklenbrauker et al. (2004) concluded that their data suggested the existence of a previously unknown BAFF-induced and PKCD-mediated nuclear signaling pathway which regulates B-cell survival.

Tu et al. (2007) found that Prkcd -/- mouse embryos showed much less ossification and delayed chondrocyte maturation in long bones compared to control embryos. The level of phospho-Marcks (177061) was lower in the cytosol of Prkcd -/- limb primordial cells than in control cells at embryonic day 14.5, suggesting MARCKS may be an endogenous PRKCD substrate.

Schwegmann et al. (2007) used microarray and quantitative RT-PCR analyses of Listeria monocytogenes (LM)-infected macrophages from Nfil6 -/- mice to identify candidate genes downstream of Nfil6 in pathways of LM killing independent of reactive nitrogen and oxygen intermediates. They found increased expression of Pkcd in LM-infected Nfil6 -/- macrophages compared with wildtype controls. Compared with LM-infected wildtype mice, LM-infected Pkcd -/- mice exhibited higher mortality accompanied by higher LM burden and increased inflammation with hepatic microabscesses, despite enhanced levels of Nfil6 and Il6. Pkcd -/- macrophages showed no impairment in activation, but they had high bacterial load and increased bacterial escape from phagosomes. Schwegmann et al. (2007) concluded that PKCD is a critical factor for confinement and killing of LM within macrophage phagosomes.