Sequence 1043(DNA-PKcs-1 , DNAPKcs1)

Sequence DNA-PKcs-1 , DNAPKcs1
Target	PRKDC ( Homo sapiens )
Description	Protein kinase, DNA-activated, catalytic polypeptide Ensembl: ENSG00000121031 UniGene: Hs.700597 EntrezGene: 5591 Ensembl Chr8: 48848222 - 49035296 Strand: -1 GO terms: 0000723 0001756 0002328 0003677 0004677 0005488 0005515 0005524 0005634 0006302 0006303 0006310 0006464 0006915 0007420 0007507 0010332 0016740 0016773 0033077 0033152 0033153
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GATCGCACCTTACTCTGTTTT / siRNA antisense (21b) AACAGAGTAAGGTGCGATCTT
Application	gene silencing
Name	DNA-PKcs-1 , DNAPKcs1

References

Silencing expression of the catalytic subunit of DNA-dependent protein kinase by small interfering RNA sensitizes human cells for radiation-induced chromosome damage, cell killing, and mutation.Peng Y, Zhang Q, Nagasawa H, Okayasu R, Liber HL, Bedford JS.Cancer Res. 2002 Nov 15;62(22) :6400-4.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The PRKDC gene encodes the catalytic subunit of a nuclear DNA-dependent serine/threonine protein kinase (DNA-PK), which is involved in DNA nonhomologous end-joining (NHEJ) during DNA double-strand break (DSB) repair and for V(D)J recombination during immune development. The second component of DNA-PK is Ku (XRCC6; 152690), which is required for proper activation of PRKDC (summary by van der Burg et al., 2009 and Woodbine et al., 2013). Gene Function. Anderson and Lees-Miller (1992) noted that DNA-PK had been shown in vitro to phosphorylate several transcription factors, suggesting that it functions in cell homeostasis by modulating transcription. DNA-PK activation requires Ku-binding to DNA double-strand breaks or other discontinuities in the DNA double helix, suggesting that DNA-PK recognizes DNA ends at sites of DNA damage or that occur as recombination intermediates. Cells defective in DNA-PK components are hypersensitive to killing by ionizing radiation due to an inability to repair double-strand breaks effectively. Cells defective in either Ku or DNA-PK catalytic subunit are also unable to perform V(D)J recombination, the site-specific recombination process that takes place in developing B and T lymphocytes to generate variable regions of immunoglobulin and T cell receptor genes. In the absence of DNA-PK function, V(D)J recombination intermediates are unable to be processed and ligated (Hartley et al., 1995).

Kuhn et al. (1995) and Labhart (1995) reported that DNA-PK suppressed RNA polymerase I transcription in both mouse and purified Xenopus cell extract, respectively, but did not inhibit transcription by RNA polymerases II or III (Labhart, 1995).

Lees-Miller et al. (1995) showed that the radiosensitive human malignant glioma M059J cell line is defective in DNA double-strand break repair and fails to express the p350 subunit of DNA-PK.

Shieh et al. (1997) demonstrated that p53 (191170) was phosphorylated at ser15 and ser37 by purified DNA-PK, and that this modification impaired the ability of MDM2 (164785) to inhibit p53-dependent transactivation. They presented evidence that these effects were most likely due to a conformational change induced by phosphorylation of p53.

Daniel et al. (1999) demonstrated that the PRKDC protein participates in retroviral DNA integration, which is catalyzed by the viral protein integrase. Prkdc-deficient murine scid cells infected with 3 different retroviruses showed a substantial reduction in retroviral DNA integration and died by apoptosis. Scid cell killing was not observed after infection with an integrase-defective virus, suggesting that abortive integration is the trigger for death in these DNA repair-deficient cells. These results suggested that the initial events in retroviral integration are detected as DNA damage by the host cell, and that completion of the integration process requires the DNA-PK-mediated repair pathway. Animal Model.Bosma et al. (1983) reported homozygous mice with features of severe combined immunodeficiency (scid), including lymphopenia, hypogammaglobulinemia, and impaired immune functions mediated by T and B lymphocytes. Hendrickson et al. (1988) determined that the defect in the scid mouse resides in the gene for a transacting factor that mediates the rejoining event for rearrangement of the immunoglobulin gene; heavy-chain gene rearrangement was found to be blocked at the D-J stage.

By linkage of scid to mahoganoid (md), a recessive mouse coat color marker on chromosome 16, Bosma et al. (1989) determined that autosomal recessive murine scid maps to the centromeric end of chromosome 16. Miller et al. (1993) constructed a refined linkage map of the centromeric region of mouse chromosome 16, placing the scid gene between Prm2 (182890) and Igl1. No recombination was found between scid and the VpreB and lambda-5 genes which are specific to developmental stages of B cells.

Komatsu et al. (1993) introduced fragments of human chromosome 8 into cells derived from scid mice by X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragments that complemented the hyperradiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting by the technique of chromosome in situ suppression hybridization, allowing assignment of the human homolog of the mouse scid locus, HYRC1 (hyperradiosensitivity complementing-1), to human chromosome 8q11. Using the same microcell technique, Kurimasa et al. (1994) demonstrated correction of radiation sensitivity by a fragment of human chromosome 8 representing 8p11.1-q11.1. Using similar methods, Komatsu et al. (1995) demonstrated that the scid cells were also fully complemented for the V(D)J recombination reaction, whereas the uncomplemented control cells failed to carry out V(D)J recombination normally. The findings indicated that the HYRC1 locus encodes the SCID factor involved in all V(D)J recombination coding joint formation and in 30 to 35% of repair of double-strand breaks.

Kirchgessner et al. (1995) identified PRKDC as a strong candidate for the human homolog of the mouse scid gene. Chromosomal fragments expressing PRKDC complemented the scid phenotype, and PRKDC protein levels were greatly reduced in cells derived from scid mice compared to cells from wildtype mice. The authors established the existence of a new synteny group between human chromosome 8q11, containing the p350 gene and the CEBPD gene (116898), and the centromeric region of mouse chromosome 16 at the position of the scid locus.

Miller et al. (1995) used a partial cDNA clone for human PRKDC to map the mouse homolog using a large interspecific backcross panel. They found that the mouse gene did not recombine with scid, consistent with the hypothesis that scid results from a mutation in the mouse Prkdc gene.