Sequence 1045(PSEN1)

From Wikisequences
Jump to: navigation, search
Sequence PSEN1
Target PSEN1 ( Homo sapiens )
Description Presenilin 1 ( Alzheimer disease 3 )

Ensembl: ENSG00000080815 UniGene: Hs.592324 EntrezGene: 5663 Ensembl Chr14: 72672908 - 72756862 Strand: 1 GO terms: 0000776 0001568 0001708 0001756 0001764 0004175 0005515 0005622 0005624 0005634 0005639 0005739 0005783 0005794 0005887 0006509 0006874 0006915 0006916 0007001 0007059 0007155 0007220

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GGTCCACTTCGTATGCTGGTT / siRNA antisense (21b) CCAGCATACGAAGTGGACCTT
Application gene silencing
Name PSEN1

References

Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation.Xie Z, Romano DM, Kovacs DM, Tanzi RE.J Biol Chem. 2004 Aug 13;279(33) :34130-7. Epub 2004 Jun 7. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Animal Model. Trower et al. (1996) used knowledge of the pufferfish (Fugu rubripes) genome to characterize the 14q24.3 region associated with autosomal dominant early-onset Alzheimer disease. Identification of genes in genomic regions associated with human diseases has been greatly facilitated by the development of techniques such as exon trapping (Buckler et al., 1991) and cDNA selection (Parimoo et al., 1991). Direct sequencing of disease loci has also been shown to be one of the most effective methods of gene detection, but it requires substantial sequencing capacity. The pufferfish (Fugu rubripes) genome is 7- to 8-fold smaller than that of the human (approximately 400 Mb compared to approximately 3,000 Mb), but it appears to contain a similar complement of genes. Thus, a typical cosmid clone of genomic DNA might be expected to contain 7 to 8 Fugu genes compared to only 1 human gene. Therefore, sequencing regions of the Fugu genome syntenic with a particular human disease region should accelerate the identification of candidate genes. Trower et al. (1996) demonstrated that 3 genes that are linked to FOS (164810) on 14q in the AD3 region have homologs in the Fugu genome adjacent to the Fugu FOS gene: dihydrolipoamide succinyltransferase (126063), S31iii125, and S20i15. In Fugu these 3 genes lie within a 12.4-kb region, compared to more than 600 kb in the human AD3 locus. The results demonstrated the conservation of synteny between the genomes of Fugu in man and highlighted the utility of this approach for sequence-based identification of genes in human disease genomic regions.

To understand the normal function of PS1, Shen et al. (1997) generated a targeted null mutation in the murine homolog of the gene. They found that homozygous PS1-deficient mice died shortly after natural birth or cesarean section. The skeleton of homozygous mutants was grossly deformed. Hemorrhages occurred in the CNS of PS1-null mutants with varying location, severity, and time of onset. The ventricular zone of homozygous deficient brains was strikingly thinner by embryonic day 14.5, indicating an impairment in neurogenesis. Bilateral cerebral cavitation caused by massive neuronal loss in specific subregions of the mutant brain was prominent after embryonic day 16.5. These results showed that PS1 is required for proper formation of the axial skeleton, normal neurogenesis, and neuronal survival. Davis et al. (1998) and Qian et al. (1998) generated mice deficient in PS1 and showed that the defects caused by the deficiency, described in detail by Shen et al. (1997), could be rescued by either wildtype human PS1 or by a human FAD-linked PS1 variant (A246E; 104311.0003), suggesting that even the mutant protein retains sufficient normal function in murine embryogenesis.

Donoviel et al. (1999) generated PS2-null mice by gene targeting, and subsequently, PS1/PS2 double-null mice. Mice homozygous for a targeted null mutation in PS2 exhibited no obvious defects; however, loss of PS2 on a PS1-null background led to embryonic lethality at embryonic day 9.5. Embryos lacking both presenilins, and surprisingly, those carrying only a single copy of PS2 on a PS1-null background, exhibited multiple early patterning defects, including lack of somite segmentation, disorganization of the trunk ventral neural tube, midbrain mesenchyme cell loss, anterior neuropore closure delays, and abnormal heart and second branchial arch development. In addition, Delta like-1 (176290) and Hes5, 2 genes that lie downstream in the Notch pathway, were misexpressed in presenilin double-null embryos. Hes5 expression was undetectable in these mice, whereas Delta like-1 was expressed ectopically in the neural tube and brain of double-null embryos. Donoviel et al. (1999) concluded that the presenilins play a widespread role in embryogenesis, that there is functional redundancy between PS1 and PS2, and that both vertebrate presenilins, like their invertebrate homologs, are essential for Notch signaling.

Wittenburg et al. (2000) demonstrated that in addition to its role in cell fate decisions in nonneuronal tissues, presenilin activity is required in terminally differentiated neurons in vivo. Mutations in the C. elegans presenilin genes sel-12 and hop-1 result in a defect in the temperature memory of the animals. This defect is caused by the loss of presenilin function in 2 cholinergic interneurons that display neurite morphology defects in presenilin mutants. The morphology and function of the affected neurons in sel-12 mutant animals can be restored by expressing sel-12 only in these cells. The wildtype human PS1, but not the familial Alzheimer disease (FAD) mutant PS1 A246E (104311.0003), can also rescue these morphologic defects. As lin-12 mutant animals display similar morphologic and functional defects to presenilin mutants, Wittenburg et al. (2000) suggested that presenilins mediate their activity in postmitotic neurons by facilitating Notch signaling. Wittenburg et al. (2000) concluded that their data indicates cell-autonomous and evolutionarily conserved control of neural morphology and function by presenilins.

Leissring et al. (2000) generated mutant PS1 knockin (KI) mice by replacing the endogenous mouse PS1 gene with human PS1 carrying the M146V mutation (104311.0007). In the KI mice, PS1 protein was expressed at physiologic levels and the endogenous tissue and cellular expression pattern was maintained. They found that agonist-evoked calcium signals were markedly potentiated in fibroblasts obtained from the KI mice. The KI cells also showed deficits in capacitative calcium entry, i.e., the influx of extracellular calcium triggered by depletion of intracellular calcium store. Both of these alterations were caused by an abnormal elevation of endoplasmic reticulum calcium stores.

Support Doctors Without Borders