Sequence 1046(PEN-2 , PEN2)

Sequence PEN-2 , PEN2
Target	PSENEN ( Homo sapiens )
Description	Presenilin enhancer 2 homolog ( C. elegans ) Ensembl: ENSG00000205155 UniGene: Hs.534465 EntrezGene: 55851 Ensembl Chr19: 40928334 - 40929743 Strand: 1 GO terms: 0005515 0005783 0005794 0005887 0006509 0007220 0016020 0016485 0042987 0043085
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TCAAAGGCTATGTCTGGCGTT / siRNA antisense (21b) CGCCAGACATAGCCTTTGATT
Application	gene silencing
Name	PEN-2 , PEN2

References

Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation.Xie Z, Romano DM, Kovacs DM, Tanzi RE.J Biol Chem. 2004 Aug 13;279(33) :34130-7. Epub 2004 Jun 7.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. PEN2 is a component of the gamma-secretase complex, which also includes presenilin (see PSEN1; 104311) and nicastrin (APH2; 605254). The gamma-secretase complex is required for the intramembrane proteolysis of a number of membrane proteins, including the amyloid-beta precursor protein (APP; 104760) and Notch (190198).Gene Function. By analyzing C. elegans mutant phenotypes, Francis et al. (2002) determined that Aph1 and Pen2 were required for Glp1/Notch-mediated signaling, both in embryonic patterning and in postembryonic germline proliferation. They observed that the human APH1 and PEN2 genes partially rescued the C. elegans mutant phenotypes, demonstrating conserved functions. Human APH1 and PEN2 had to be provided together to rescue the mutant phenotypes, and inclusion of PSEN1 improved rescue. Francis et al. (2002) concluded that APH1 and PEN2 cooperate closely in the same process to promote presenilin activity. Using RNA-mediated interference assays to inactivate Aph1, Pen2, or nicastrin in cultured Drosophila cells, Francis et al. (2002) observed reduction in gamma-secretase cleavage of beta-APP and Notch substrates and reduction in the levels of processed presenilin. They concluded that APH1 and PEN2 are required for Notch pathway signaling, gamma-secretase cleavage of beta-APP, and presenilin protein accumulation. In a commentary, Goutte (2002) discussed the contribution of Francis et al. (2002) to current understanding of how presenilins mediate the gamma-secretase cleavage of Notch transmembrane receptors and transmembrane beta-APP.

Using coimmunoprecipitation experiments, Steiner et al. (2002) showed that PEN2 binds to nicastrin, PSEN1, and PSEN2 (600759), and they concluded that PEN2 is a critical component of PSEN1/gamma-secretase and PSEN2/gamma-secretase complexes. Steiner et al. (2002) observed that Pen2 levels were reduced in mice lacking Psen1 or both Psen1 and Psen2. They also observed that PEN2 levels were reduced upon RNA interference-mediated downregulation of nicastrin. Steiner et al. (2002) concluded that PEN2 expression requires the presence of presenilins and nicastrin. Additionally, they reported that downregulation of PEN2 by RNA interference was associated with reduced presenilin levels, impaired nicastrin maturation, and deficient gamma-secretase complex formation.

Gamma-secretase activity requires the formation of a stable, high molecular mass protein complex that, in addition to the endoproteolyzed fragmented form of presenilin, contains essential cofactors including nicastrin (605254), APH1 (607629, 607630), and PEN2. Takasugi et al. (2003) showed that Drosophila APH1 increases the stability of Drosophila presenilin holoprotein in the complex. Depletion of PEN2 by RNA interference prevented endoproteolysis of presenilin and promoted stabilization of the holoprotein in both Drosophila and mammalian cells, including primary neurons. Coexpression of Drosophila Pen2 with Aph1 and nicastrin increased the formation of presenilin fragments as well as gamma-secretase activity. Thus, Takasugi et al. (2003) concluded that APH1 stabilizes the presenilin holoprotein in the complex, whereas PEN2 is required for endoproteolytic processing of presenilin and conferring gamma-secretase activity to the complex.

Didych et al. (2013) cloned a 269-bp fragment containing the initial parts of the first exons of U2AF1L4 and PSENEN and, using luciferase analysis and fluorescence microscopy, found that both genes were expressed simultaneously. RT-PCR analysis revealed moderate tissue specificity for both genes, although the level of U2AF1L4 may have been underestimated due to the presence of different splice forms. Didych et al. (2013) concluded that the short DNA region between the PSENEN and U2AF1L4 genes behaves as a bidirectional promoter that binds several characteristic transcription factors. They noted that both U2AF1L4 and PSENEN are involved in regulation of T-cell activity.

Molecular GeneticsAnimal Model.By screening a library of about 80,000 chemical compounds, Kounnas et al. (2010) identified a class of gamma-secretase modulators (GSMs), diarylaminothiazoles, or series A GSMs, that could target production of the fibrillogenic peptides amyloid (A)-beta-42 and A-beta-40 (see 104760) in cell lines and in Tg 2576 transgenic Alzheimer disease (AD; 104300) mice. Immobilized series A GSMs bound to Pen2 and, to a lesser degree, Psen1. Series A GSMs reduced gamma-secretase activity without interfering with related off-target reactions, lowered A-beta-42 levels in both plasma and brain of Tg 2576 mice, and reduced plaque density and amyloid in Tg 2576 hippocampus and cortex. Daily dosing was well tolerated over the 7-month study.