Sequence 1047(ISIS-116847 , ISIS 116847)
| Sequence ISIS-116847 , ISIS 116847 | |
|---|---|
| Target | Pten ( Homo sapiens / Mus musculus ) |
| Description | Phosphatase and tensin homolog ( mutated in multiple advanced cancers 1 )
Ensembl: ENSG00000171862 UniGene: Hs.500466 EntrezGene: 5728 Ensembl Chr10: 89613175 - 89718511 Strand: 1 GO terms: 0000079 0001525 0004438 0004722 0004725 0005161 0005515 0005737 0006470 0006629 0006917 0007049 0007417 0007507 0008138 0008283 0008285 0008289 0016311 0016314 0016787 0016791 0030165 |
| Design | MOE gapmer |
| Chemistry | moC*moT*moG*moC*moT*A*G*C*C*T*C*T*G*G*A*moT*moT*moT*moG*moA |
| Sequence | CTGCTAGCCTCTGGATTTGA |
| Application | gene silencing |
| Name | ISIS-116847 , ISIS 116847 |
References
Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
