Sequence 1048(FAK)

From Wikisequences
Jump to: navigation, search
Sequence FAK
Target PTK2 ( Homo sapiens )
Description PTK2 protein tyrosine kinase 2

Ensembl: ENSG00000169398 UniGene: Hs.395482 EntrezGene: 5747 Ensembl Chr8: 141737683 - 142080514 Strand: -1 GO terms: 0000166 0000226 0001525 0001568 0001570 0001764 0004672 0004674 0004713 0005515 0005524 0005856 0005925 0006468 0007229 0016324 0016740 0030027 0030054 0030198 0040023 0042169 0043542

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) CCACCTGGGCCAGTATTATTT / siRNA antisense (21b) ATAATACTGGCCCAGGTGGTT
Application gene silencing
Name FAK

References

RNA interference targeting focal adhesion kinase enhances pancreatic adenocarcinoma gemcitabine chemosensitivity.Duxbury MS, Ito H, Benoit E, Zinner MJ, Ashley SW, Whang EE.Biochem Biophys Res Commun. 2003 Nov 21;311(3) :786-92. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Gene Function. Andre and Becker-Andre (1993) described focal adhesion kinase. (See also 601212.) It concentrates in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents, such as fibronectin. PTK2 contains phosphotyrosine in growing BALB/c 3T3 cells but contains little or no phosphotyrosine in cells detached by trypsinization. The tyrosine-phosphorylated state is regained within minutes when the cells are replated and anchored onto fibronectin. PTK2 appears to be a major substrate for the Rous virus-encoded oncoprotein, pp60v-src (see SRC, 190090), which transforms and confers anchorage independence on chicken embryo fibroblasts (Schaller et al., 1992). A marked increase in tyrosine phosphorylation of PTK2 is also observed after treatment of cells with cholecystokinin, bombesin, vasopressin, and endothelin. Thus, activation of PTK2 may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to several neural peptides and/or to cell interactions with the extracellular matrix.

Using a yeast 2-hybrid screen, Polte and Hanks (1995) identified a Crk-associated tyrosine kinase substrate, p130Cas (BCAR1; 602941), as a Ptk2-interacting protein. Polte and Hanks (1995) demonstrated that Ptk2 and p130Cas are stably associated in mouse fibroblasts and that this interaction requires the proline-rich region of Ptk2 and the Src homology 3 domain of p130Cas. Polte and Hanks (1995) suggested that the interaction between Ptk2 and p130Cas is a key element in integrin-mediated signal transduction and that it represents a direct molecular link between the Src and Crk (164762) oncoproteins.

Hsia et al. (2003) stated that the null mutation of Fak in mice results in embryonic lethality and that Fak-null fibroblasts exhibit cell migration defects in culture. They found that viral Src (v-Src) transformation promoted integrin (see ITGA3, 605025)-stimulated motility equal to stable Fak reexpression. However, v-Src-transformed Fak-null cells failed to exhibit an invasive phenotype. Fak tyr397 phosphorylation, kinase activity, and C-terminal SH3-binding sites were required to generate the invasive cell phenotype. Cell invasion was linked to transient Fak accumulation at lamellipodia, formation of a Fak-Src-p130Cas-Dock180 (601409) signaling complex, elevated Rac (see 602048) and c-Jun N-terminal kinase (see 601158) activation, and increased matrix metalloproteinase (e.g., MMP2, 120360) expression and activity.

Torsoni et al. (2003) found that PTK2 was rapidly activated by cyclic stretch in neonatal rat ventricular myocytes and that the activation was accompanied by translocation from the perinuclear area to costamere sites in the stretched cells. Disruption of endogenous PTK2/Src signaling inhibited stretch-induced atrial natriuretic factor (ANF; 108780) gene activation. Torsoni et al. (2003) concluded that PTK2 plays an important role in the early upregulation of ANF transcription induced by mechanical stress in cardiac myocytes and may coordinate the cellular signaling machinery that controls gene expression associated with load-induced cardiac myocyte hypertrophy.

Beggs et al. (2003) found that targeted disruption of the Fak gene in mouse radial glial cells and meningeal fibroblasts in the developing dorsal forebrain resulted in local disruptions of the cortical basement membrane located between the neuroepithelium and the pia-meninges. At disruption sites, clusters of ectopic neurons invaded the marginal zone. Deletion of Fak from neurons resulted in abnormal dendrite morphology and complexity, but did not affect aberrant neuronal positioning. Beggs et al. (2003) noted that the cortical disorganization resembled lissencephaly phenotypes seen in some forms of congenital muscular dystrophy such as Walker-Warburg syndrome, now designated muscular dystrophy-dystroglycanopathy type A (see 236670). Animal Model.Ilic et al. (1995) found pronounced mesodermal defects in Fak-null embryos at embryonic day 8.5. Development of the anterioposterior axis was retarded and that of mesoderm was poor: head mesenchyme was involuted, and no notochord or somite was formed. Cultured mesodermal cells from mutant embryos showed reduced mobility, and the number of focal adhesions was increased. Ilic et al. (1995) concluded that FAK may be involved in the turnover of focal adhesion contacts during cell migration.

McLean et al. (2004) examined the role of FAK in skin tumor formation using mice with a regulated deletion of Fak targeted to the epidermis. Deletion of Fak prior to chemical induction of skin tumors inhibited papilloma formation, and deletion of Fak after benign tumors had formed inhibited malignant progression. Fak deletion was associated with reduced keratinocyte migration in vitro and increased keratinocyte cell death in vitro and in vivo, but it had no effect on wound reepithelialization in vivo. McLean et al. (2004) concluded that FAK enhances apoptosis and modulates the efficiency of benign tumor formation and malignant conversion.

Peng et al. (2006) stated that the lethal embryonic phenotype of Fak gene inactivation in mice included an abnormal heart and lack of fully developed blood vessels. Peng et al. (2006) generated ventricular cardiomyocyte-specific Fak-null mice and found Fak inactivation promoted eccentric cardiac hypertrophy and fibrosis in response to angiotensin II (see 106150) stimulation. By 9 months of age, these mice also developed spontaneous left ventricular chamber dilation. Peng et al. (2006) concluded that FAK is a regulator of heart hypertrophy.

Peng et al. (2008) showed that targeted inactivation of Fak in embryonic mouse heart resulted in thin ventricular walls and ventricular septal defects leading to high embryonic mortality. Decreased cell proliferation, but not increased apoptosis or differentiation, caused the thin ventricular walls. Surviving knockout mice displayed spontaneous right ventricular hypertrophy, which was related to downregulation of Mef2a (600660)-mediated signal transduction.

Support Doctors Without Borders