Sequence 1050(cOff-track , cOfftrack)
| Sequence cOff-track , cOfftrack | |
|---|---|
| Target | PTK7 ( Gallus gallus ) |
| Description | PTK7 protein tyrosine kinase 7
Ensembl: ENSG00000112655 UniGene: Hs.90572 EntrezGene: 5754 Ensembl Chr6: 43152007 - 43237435 Strand: 1 GO terms: 0001843 0004672 0004674 0004713 0004714 0004872 0005021 0005515 0005524 0005887 0006468 0007155 0007165 0016020 0016021 0045198 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAACGAAGAGGCCATGTTTTT / siRNA antisense (21b) AAACATGGCCTCTTCGTTCTT |
| Application | gene silencing |
| Name | cOff-track , cOfftrack |
References
Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling.Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Yabuki M, Harada K, Hori M, Kikutani H.Nat Cell Biol. 2004 Dec;6(12) :1204-11. Epub 2004 Nov 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Animal Model. Lu et al. (2004) demonstrated that a mutation in the mouse Ptk7 gene, which encodes an evolutionarily conserved transmembrane protein with tyrosine kinase homology, disrupts neural tube closure and stereociliary bundle orientation, and shows genetic interactions with a mutation in the mouse Van Gogh homolog Vangl2 (600533). Lu et al. (2004) also showed that PTK7 is dynamically localized during hair cell polarization, and that the Xenopus homolog of PTK7 is required for neural convergent extension and neural tube closure. Lu et al. (2004) concluded that their results identified PTK7 as a novel regulator of planar cell polarity in vertebrates.
