Sequence 1052(ATRIR 2 , ATRIR2)
From Wikisequences
Sequence ATRIR_2 , ATRIR2 | |
---|---|
Target | RAB11B ( Homo sapiens ) |
Description | RAB11B, member RAS oncogene family
Ensembl: ENSG00000141934 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) AGAGGAACAGAGAAGATCACA / siRNA antisense (21b) TGATCTTCTCTGTTCCTCTTT |
Application | gene silencing |
Name | ATRIR_2 , ATRIR2 |
References
Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint.Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T.Genes Dev. 2004 Sep 1;18(17) :2108-19.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478