Sequence 1052(ATRIR 2 , ATRIR2)

From Wikisequences
Jump to: navigation, search
Sequence ATRIR_2 , ATRIR2
Target RAB11B ( Homo sapiens )
Description RAB11B, member RAS oncogene family

Ensembl: ENSG00000141934

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) AGAGGAACAGAGAAGATCACA / siRNA antisense (21b) TGATCTTCTCTGTTCCTCTTT
Application gene silencing
Name ATRIR_2 , ATRIR2

References

Human Rif1, ortholog of a yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the S-phase checkpoint.Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T.Genes Dev. 2004 Sep 1;18(17) :2108-19. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders