Sequence 1059(Raldh2-2 , Raldh22)
From Wikisequences
Sequence Raldh2-2 , Raldh22 | |
---|---|
Target | Raldh2 ( Gallus gallus ) |
Description | |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TACAACAAGATCTTGGAACTT / siRNA antisense (21b) GTTCCAAGATCTTGTTGTATT |
Application | gene silencing |
Name | Raldh2-2 , Raldh22 |
References
In vivo comparative study of RNAi methodologies by in ovo electroporation in the chick embryo.Rao M, Baraban JH, Rajaii F, Sockanathan S.Dev Dyn. 2004 Nov;231(3) :592-600.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478