Sequence 1066(RasGRP1-RNAi2174 , RasGRP1RNAi2174)
From Wikisequences
Sequence RasGRP1-RNAi2174 , RasGRP1RNAi2174 | |
---|---|
Target | RASGRP1 ( Homo sapiens ) |
Description | RAS guanyl releasing protein 1 ( calcium and DAG-regulated )
Ensembl: ENSG00000172575 UniGene: Hs.591127 EntrezGene: 10125 Ensembl Chr15: 36567590 - 36644224 Strand: -1 GO terms: 0005085 0005088 0005509 0005515 0005622 0005624 0007242 0007264 0007265 0008270 0008289 0051056 |
Design | shRNA |
Chemistry | RNA |
Sequence | (63b) GATCCCAGCGGGCTTTTGTCAAGTGTTCAAGAGACACTTGACAAAAGCCCGCTTTTTTGGAAA |
Application | gene silencing |
Name | RasGRP1-RNAi2174 , RasGRP1RNAi2174 |
References
A diacylglycerol-protein kinase C-RasGRP1 pathway directs Ras activation upon antigen receptor stimulation of T cells.Roose JP, Mollenauer M, Gupta VA, Stone J, Weiss A.Mol Cell Biol. 2005 Jun;25(11) :4426-41.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478