Sequence 1072(RB
From Wikisequences
Sequence RB#2 | |
---|---|
Target | RB1 ( Homo sapiens ) |
Description | Retinoblastoma 1 ( including osteosarcoma )
Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 0030521 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) ATGGAAGATGATCTGGTGATTCAAGAGATCACCAGATCATCTTCCATTT |
Application | gene silencing |
Name | RB#2 |
References
The tumor-suppressive functions of the human INK4A locus.Voorhoeve PM, Agami R.Cancer Cell. 2003 Oct;4(4) :311-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478