Sequence 1072(RB

From Wikisequences
Jump to: navigation, search
Sequence RB#2
Target RB1 ( Homo sapiens )
Description Retinoblastoma 1 ( including osteosarcoma )

Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 0030521

Design shRNA
Chemistry RNA
Sequence (49b) ATGGAAGATGATCTGGTGATTCAAGAGATCACCAGATCATCTTCCATTT
Application gene silencing
Name RB#2

References

The tumor-suppressive functions of the human INK4A locus.Voorhoeve PM, Agami R.Cancer Cell. 2003 Oct;4(4) :311-9.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders