Sequence 1073(siRB1.1)
| Sequence siRB1.1 | |
|---|---|
| Target | RB1 (Homo sapiens) |
| Description | Retinoblastoma 1 (including osteosarcoma)
Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 0030521 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CGTGTAAATTCTACTGCAATT / siRNA antisense (21b) TTGCAGTAGAATTTACACGCG |
| Application | gene silencing |
| Name | siRB1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Clinical Features. Patients with cancer of the urinary bladder often present with multiple tumors appearing at different times and at different sites in the bladder. This observation had been attributed to a 'field defect' in the bladder that allowed the independent transformation of epithelial cells at a number of sites. Sidransky et al. (1992) tested this hypothesis with molecular genetic techniques and concluded that in fact multiple bladder tumors are of clonal origin. A number of bladder tumors can arise from the uncontrolled spread of a single transformed cell. These tumors can then grow independently with variable subsequent genetic alterations.
Dyrskjot et al. (2003) reported the identification of clinically relevant subclasses of bladder carcinoma using expression microarray analysis of 40 well-characterized bladder tumors. Gene expression profiles characterizing each stage and subtype identified their biologic properties, producing potential targets for therapy.
