Sequence 1075(RbAp48)
| Sequence RbAp48 | |
|---|---|
| Target | RBBP4 ( Homo sapiens ) |
| Description | Retinoblastoma binding protein 4
Ensembl: ENSG00000162521 UniGene: Hs.647652 EntrezGene: 5928 Ensembl Chr1: 32889411 - 32918845 Strand: 1 GO terms: 0005515 0005634 0006260 0006338 0006350 0006355 0007049 0008094 0008285 0016581 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCCACTCAGTTGATGCTCATT / siRNA antisense (21b) TGAGCATCAACTGAGTGGCTT |
| Application | gene silencing |
| Name | RbAp48 |
References
Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres.Hayashi T, Fujita Y, Iwasaki O, Adachi Y, Takahashi K, Yanagida M.Cell. 2004 Sep 17;118(6) :715-29.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. Qian et al. (1993) demonstrated that RBBP4 and RB1 formed complexes in vitro and in vivo; these complexes apparently involve direct interactions between the proteins. Qian et al. (1993) also demonstrated that RBBP4 could mimic the function of Msi1 in yeast.
By gel filtration of MOLT-4 human T cells, Schmit et al. (2007) identified RBAP48 as a subunit of the over 669-kD LIN complex. Other stable LIN complex components included LIN9 (609375), LIN37, LIN54 (613367), and BMYB (MYBL2; 601415). All endogenous or epitope-tagged LIN complex subunits coimmunoprecipitated with one another, and all were efficiently codepleted together with antibodies directed to LIN9. The LIN complex associated with E2F (see 189971)-regulated promoters in the T98G human glioblastoma cell line and was required for activation of G2/M genes. Depletion of LIN complex subunits had no significant effect on expression of G1/S genes.
