Sequence 1076(RbAp46)

From Wikisequences
Jump to: navigation, search
Sequence RbAp46
Target RBBP7 ( Homo sapiens )
Description Retinoblastoma binding protein 7

Ensembl: ENSG00000102054 UniGene: Hs.495755 EntrezGene: 5931 Ensembl ChrX: 16772385 - 16798386 Strand: -1 GO terms: 0005515 0005634 0006260 0006350 0006355 0007275 0008283 0016568

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GGAGAAGTAAACCGTGCTCTT / siRNA antisense (21b) GAGCACGGTTTACTTCTCCTT
Application gene silencing
Name RbAp46

References

Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres.Hayashi T, Fujita Y, Iwasaki O, Adachi Y, Takahashi K, Yanagida M.Cell. 2004 Sep 17;118(6) :715-29. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders