Sequence 1077(siRBX1.1)
From Wikisequences
Sequence siRBX1.1 | |
---|---|
Target | RBX1 (Homo sapiens) |
Description | Ring-box 1
Ensembl: ENSG00000100387 UniGene: Hs.474949 EntrezGene: 9978 Ensembl Chr22: 39677336 - 39699473 Strand: 1 GO terms: 0005515 0005634 0005737 0006281 0006512 0008270 0030163 0046872 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGGATATTGTGGTTGATAATT / siRNA antisense (21b) TTATCAACCACAATATCCCAG |
Application | gene silencing |
Name | siRBX1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
