Sequence 1081(RhoA-4 , RhoA4)
From Wikisequences
Sequence RhoA-4 , RhoA4 | |
---|---|
Target | Rhoa ( Rattus norvegicus ) |
Description | Ras homolog gene family, member A
Ensembl: ENSRNOG00000012630 UniGene: Rn.107401 EntrezGene: 117273 Ensembl Chr2: 200047945 - 200054372 Strand: 1 GO terms: 0000166 0003924 0004871 0005515 0005525 0005622 0005634 0005856 0005886 0007264 0030036 0043123 0045665 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TGAAGCAGGAGCCGGTAAATT / siRNA antisense (21b) TTTACCGGCTCCTGCTTCATT |
Application | gene silencing |
Name | RhoA-4 , RhoA4 |
References
Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A.Ahmed Z, Dent RG, Suggate EL, Barrett LB, Seabright RJ, Berry M, Logan A.Mol Cell Neurosci. 2005 Mar;28(3) :509-23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
