Sequence 1086(DBC2-b , DBC2b)

Sequence DBC2-b , DBC2b
Target	RHOBTB2 ( Homo sapiens )
Description	Rho-related BTB domain containing 2 Ensembl: ENSG00000008853 UniGene: Hs.372688 EntrezGene: 23221 Ensembl Chr8: 22913059 - 22933655 Strand: 1 GO terms: 0000166 0003677 0003700 0005515 0005525 0005622 0005634 0007264 0007275 0015031
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CCAGGAGTATTTCGAGAAGTT / siRNA antisense (21b) CTTCTCGAAATACTCCTGGTT
Application	gene silencing
Name	DBC2-b , DBC2b

References

DBC2 significantly influences cell-cycle, apoptosis, cytoskeleton and membrane-trafficking pathways.Siripurapu V, Meth J, Kobayashi N, Hamaguchi M.J Mol Biol. 2005 Feb 11;346(1) :83-9. Epub 2004 Dec 8.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. RHOBTB2 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (607351).Gene Function. By yeast 2-hybrid analysis and coimmunoprecipitation of endogenous proteins from HeLa and HEK293 cells, Wilkins et al. (2004) found that RHOBTB2 bound to the ubiquitin ligase scaffold protein CUL3 (603136). RHOBTB2 did not bind to any other cullin family members, and the interaction required the first BTB domain of RHOBTB2. RHOBTB2 carrying a tyr284-to-asp (Y284D) mutation in the first BTB domain, which was found in a lung cancer cell line, was unable to bind CUL3 and avoided degradation by the ubiquitin/proteasome system, resulting in increased RHOBTB2 protein levels in vivo.