Sequence 1088(siRHOC.2)
From Wikisequences
Sequence siRHOC.2 | |
---|---|
Target | RHOC (Homo sapiens) |
Description | Ras homolog gene family, member C
Ensembl: ENSG00000155366 UniGene: Hs.502659 EntrezGene: 389 Ensembl Chr1: 113045272 - 113051548 Strand: -1 GO terms: 0000166 0003924 0004871 0005515 0005525 0005622 0005634 0005886 0006096 0006886 0006913 0007165 0007264 0015031 0016616 0043123 0044262 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CTACTGTCTTTGAGAACTATT / siRNA antisense (21b) TAGTTCTCAAAGACAGTAGGG |
Application | gene silencing |
Name | siRHOC.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478