Sequence 1099(rluc)

From Wikisequences
Jump to: navigation, search
Sequence rluc
Target rluc ( Renilla reniformis)
Description
Design shRNA
Chemistry RNA
Sequence (49b) GTAGCGCGGTGTATTATACTTCAAGAGAGTATAATACACCGCGCTACTT
Application gene silencing
Name rluc

References

Specific inhibition of HIV-1 replication by short hairpin RNAs targeting human cyclin T1 without inducing apoptosis.Li Z, Xiong Y, Peng Y, Pan J, Chen Y, Wu X, Hussain S, Tien P, Guo D.FEBS Lett. 2005 Jun 6;579(14) :3100-6. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders