Sequence 10 (LZR-20 , LZR20)

Sequence LZR-20 , LZR20
Target	3D ( HRV-16 )
Description
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CCTTGATGTTAGATGGAGATT / siRNA antisense (21b) TCTCCATCTAACATCAAGGTT
Application	gene silencing
Name	LZR-20 , LZR20

References

Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.Antiviral Res. 2004 Jan;61(1) :49-55.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Pathogenesis. The primary route of entry for human rhinoviruses is the upper respiratory tract (mouth and nose). Afterward, the virus binds to ICAM-1 (Inter-Cellular Adhesion Molecule 1) also known as CD54 (Cluster of Differentiation 54) receptors on respiratory epithelial cells. As the virus replicates and spreads, infected cells release distress signals known as chemokines and cytokines (which in turn activate inflammatory mediators). Cell lysis occurs at the upper respiratory epithelium. Infection occurs rapidly, with the virus adhering to surface receptors within 15 minutes of entering the respiratory tract. High risk individuals include children and the elderly. Just over 50% of individuals will experience symptoms within 2 days of infection. Only about 5% of cases will have an incubation period of less than 20 hours, and, at the other extreme, it is expected that 5% of cases would have an incubation period of greater than four and a half days (Lessler et al 2009).

Structure. Rhinoviruses have single-stranded positive sense RNA genomes of between 7.2 and 8.5 kb in length. At the 5' end of the genome is a virus-encoded protein, and like mammalian mRNA, there is a 3' poly-A tail. Structural proteins are encoded in the 5' region of the genome and non structural at the 3' end. This is the same for all picornaviruses. The viral particles themselves are not enveloped and are icosahedral in structure. The viral proteins are transcribed as a single, long polypeptide, which is cleaved into the structural and nonstructural viral proteins (Couch, 2005). Human rhinoviruses are composed of a capsid, that contains four viral proteins VP1, VP2, VP3 and VP4. VP1, VP2, and VP3 form the major part of the protein capsid. The much smaller VP4 protein has a more extended structure, and lies at the interface between the capsid and the RNA genome. There are 60 copies of each of these proteins assembled as an icosahedron. Antibodies are a major defense against infection with the epitopes lying on the exterior regions of VP1-VP3.