Sequence 1100(M 28S)
From Wikisequences
Sequence M 28S | |
---|---|
Target | Rn28s1 ( Mus musculus ) |
Description | Ensembl: ENSMUSG00000089855 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (24b) ATACCGGCACGAGACCGATAGTCA / Reverse PCR primer (22b) GCGGACCCCACCCGTTTACCTC |
Application | gene expression |
Name | M 28S |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
