Sequence 1107(S6K2)

Sequence S6K2
Target	RPS6KB2 ( Homo sapiens )
Description	Ribosomal protein S6 kinase, 70kDa, polypeptide 2 Ensembl: ENSG00000175634 UniGene: Hs.534345 EntrezGene: 6199 Ensembl Chr11: 66952511 - 66959454 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005524 0006412 0006468 0007165 0016740 0043491
Design	shRNA
Chemistry	RNA
Sequence	(56b) GGCTGAGCGGAACATTCTAGTTCAAGCTTCTAGAATGTTCCGCTCAGCCCTTTTTG
Application	gene silencing
Name	S6K2

References

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. RPS6KB1 mediates the rapid phosphorylation of ribosomal protein S6 (180460) on multiple serine residues in response to insulin or several classes of mitogens (Grove et al., 1991). Gene Function. Grove et al. (1991) found that transient expression of p70 S6K alpha-I and alpha-II in COS-7 cells resulted in a 2.5- to 4.0-fold increase in overall S6 kinase activity. Immunoblot analysis detected alpha-I and alpha-II as closely spaced ladders of polypeptides between 85 and 90 kD and between 65 and 70 kD, respectively. Only the alpha-I and alpha-II proteins of slowest mobility were associated with S6 kinase activity. The slower mobility and higher enzymatic activity of the rat p70 S6K proteins were due to serine/threonine phosphorylation, since phosphatase-2A inactivated the kinase activity and increased the mobility of the bands on polyacrylamide gels. Grove et al. (1991) concluded that acquisition of S6 protein kinase catalytic function is restricted to the most extensively phosphorylated polypeptides.

Gout et al. (1998) examined the catalytic activity of p70 alpha-1 transiently expressed in Chinese hamster ovary cells stably expressing human insulin receptor (147670). S6 kinase activity was stimulated by insulin, serum, phorbol ester, and PDGF (see 190040). In transfected human embryonic kidney cells, serum-activated kinase activity was potently inhibited by rapamycin and wortmannin in a dose-dependent manner, suggesting that MTOR (601231) and PI3 kinase (see 602925) are involved in p70 alpha-1 activation.

Saitoh et al. (1998) characterized p70 S6K-alpha expressed by human embryonic kidney cells. A 32-mer S6 peptide was phosphorylated by the wildtype kinase, but not by a catalytically inactivated lys100-to-arg mutant kinase.

In mammals, MTOR cooperates with PI3K-dependent effectors in a biochemical signaling pathway to regulate the size of proliferating cells. Fingar et al. (2002) presented evidence that rat S6k1 alpha-II, Eif4e (133440), and Eif4ebp1 (602223) mediate Mtor-dependent cell size control.

Holz et al. (2005) showed that MTOR and S6K1 maneuvered on and off the EIF3 (see 602039) translation initiation complex in HEK293 cells in a signal-dependent, choreographed fashion. When inactive, S6K1 associated with the EIF3 complex, while the S6K1 activator MTOR, in association with its binding partner RAPTOR (607130), did not. Hormone- or mitogen-mediated cell stimulation promoted MTOR/RAPTOR binding to the EIF3 complex and phosphorylation of S6K1. Phosphorylation resulted in S6K1 dissociation and activation, followed by phosphorylation of S6K1 targets, including EIF4B (603928), which, upon phosphorylation, was recruited into the EIF3 complex. Holz et al. (2005) concluded that the EIF3 preinitiation complex acts as a scaffold to coordinate responses to stimuli that promote efficient protein synthesis. Animal Model.Shima et al. (1998) generated mice deficient in S6k1 by targeted disruption. These mice were viable and fertile, but exhibited a conspicuous reduction in body size during embryogenesis, an effect that was mostly overcome by adulthood. Shima et al. (1998) hypothesized that the weak penetrance of the phenotype may arise from increased expression in S6k1-deficient mice of the highly homologous gene S6k2.

Pende et al. (2000) showed that mice deficient for S6k1, a known effector of the phosphatidylinositide-3-OH kinase signaling pathway, were hypoinsulinemic and glucose intolerant. Whereas insulin resistance was not observed in isolated muscle, such mice exhibited a sharp reduction in glucose-induced insulin secretion and in pancreatic insulin content. This was not due to a lesion in glucose sensing or insulin production, but to a reduction in pancreatic endocrine mass, which was accounted for by a selective decrease in beta-cell size. Pende et al. (2000) concluded that the observed phenotype closely parallels those of preclinical type II diabetes mellitus, in which malnutrition-induced hypoinsulinemia predisposes individuals to glucose intolerance.

Pende et al. (2004) found that mice deficient in S6k1 or S6k2 were born at expected mendelian ratios. Compared with wildtype mice, S6k1 -/- mice were significantly smaller, and S6k2 -/- mice tended to be slightly larger. Mice lacking both genes showed a sharp reduction in viability due to perinatal lethality. Analysis of S6 phosphorylation in the cytoplasm and nucleoli of cells derived from each S6k genotype suggested that both kinases are required for full S6 phosphorylation, but that S6k2 may contribute more to the response. Despite the impairment of S6 phosphorylation in cells from double-knockout mice, cell cycle progression and translation of 5-prime terminal oligopyrimidine mRNAs were still modulated by mitogens in a rapamycin-dependent manner. Double-knockout cells also showed persistence of S6 phosphorylation on the first 2 serines phosphorylated in response to mitogens, and this step was catalyzed by a MAPK-dependent kinase. Pende et al. (2004) concluded that a redundancy exists between the S6K and MAPK pathways in mediating early S6 phosphorylation in response to mitogens.

Um et al. (2004) reported that S6k1-deficient mice are protected against obesity due to enhanced beta-oxidation; however, on a high-fat diet, levels of glucose and free fatty acids still rose in S6k1-deficient mice, resulting in insulin receptor desensitization. Nevertheless, S6k1-deficient mice remained sensitive to insulin due to the apparent loss of a negative feedback loop from S6k1 to insulin receptor substrate-1 (IRS1; 147545), which blunts phosphorylation of serines at positions 307, 636, and 639, all sites involved in insulin resistance. Moreover, wildtype mice on a high-fat diet as well as K/K A(y) and ob/ob mice had markedly elevated S6k1 activity and, unlike S6k1-deficient mice, increased phosphorylation of Irs1 serines at positions 307, 636, and 639. Um et al. (2004) concluded that under conditions of nutrient satiation, S6K1 negatively regulates insulin signaling.

Selman et al. (2009) demonstrated in mice that deletion of S6K1, a component of the nutrient-responsive mTOR signaling pathway, led to increased life span and resistance to age-related pathologies such as bone, immune, and motor dysfunction and loss of insulin sensitivity. Deletion of S6K1 induced gene expression patterns similar to those seen in caloric restriction or with pharmacologic activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK), a conserved regulator of the metabolic response to caloric restriction.