Sequence 1112(NgR-5 , NgR5)
From Wikisequences
| Sequence NgR-5 , NgR5 | |
|---|---|
| Target | Rtn4r ( Rattus norvegicus ) |
| Description | Reticulon 4 receptor
Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) TGACTCTCCATTTGGGACTTT / siRNA antisense (21b) AGTCCCAAATGGAGAGTCATT |
| Application | gene silencing |
| Name | NgR-5 , NgR5 |
References
Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A.Ahmed Z, Dent RG, Suggate EL, Barrett LB, Seabright RJ, Berry M, Logan A.Mol Cell Neurosci. 2005 Mar;28(3) :509-23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
