Sequence 1112(NgR-5 , NgR5)

From Wikisequences
Jump to: navigation, search
Sequence NgR-5 , NgR5
Target Rtn4r ( Rattus norvegicus )
Description Reticulon 4 receptor

Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) TGACTCTCCATTTGGGACTTT / siRNA antisense (21b) AGTCCCAAATGGAGAGTCATT
Application gene silencing
Name NgR-5 , NgR5

References

Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A.Ahmed Z, Dent RG, Suggate EL, Barrett LB, Seabright RJ, Berry M, Logan A.Mol Cell Neurosci. 2005 Mar;28(3) :509-23. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders