Sequence 1113(ISIS-353382 , ISIS 353382)
From Wikisequences
Sequence ISIS-353382 , ISIS 353382 | |
---|---|
Target | Srb1 ( Mus musculus ) |
Description | Scavenger receptor class B , member 1
Ensembl: ENSMUSG00000037936 UniGene: Mm.282242 EntrezGene: 20778 |
Design | MOE gapmer |
Chemistry | moG*moC*moT*moT*moC*A*G*T*C*A*T*G*A*C*T*moT*moC*moC*moT*moT |
Sequence | GCTTCAGTCATGACTTCCTT |
Application | gene silencing |
Name | ISIS-353382 , ISIS 353382 |
References
Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478