Sequence 1113(ISIS-353382 , ISIS 353382)

From Wikisequences
Jump to: navigation, search
Sequence ISIS-353382 , ISIS 353382
Target Srb1 ( Mus musculus )
Description Scavenger receptor class B , member 1

Ensembl: ENSMUSG00000037936 UniGene: Mm.282242 EntrezGene: 20778

Design MOE gapmer
Chemistry moG*moC*moT*moT*moC*A*G*T*C*A*T*G*A*C*T*moT*moC*moC*moT*moT
Sequence GCTTCAGTCATGACTTCCTT
Application gene silencing
Name ISIS-353382 , ISIS 353382

References

Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders