Sequence 1114(cSema6D)
| Sequence cSema6D | |
|---|---|
| Target | SEMA6D ( Gallus gallus ) |
| Description | Sema domain, transmembrane domain ( TM ), and cytoplasmic domain, ( semaphorin ) 6D
Ensembl: ENSG00000137872 UniGene: Hs.511265 EntrezGene: 80031 Ensembl Chr15: 45797978 - 45853709 Strand: 1 GO terms: 0004866 0004872 0005737 0007275 0007399 0016020 0016021 0030154 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCAGGAAATTAACATGGAGTT / siRNA antisense (21b) CTCCATGTTAATTTCCTGCTT |
| Application | gene silencing |
| Name | cSema6D |
References
Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling.Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Yabuki M, Harada K, Hori M, Kikutani H.Nat Cell Biol. 2004 Dec;6(12) :1204-11. Epub 2004 Nov 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. Qu et al. (2002) exposed chicken embryo dorsal root ganglion explants and neonatal rat cortical and hippocampal neurons to SEMA6D secreted from transfected COS-7 cells and found that SEMA6D induced growth cone collapse. SEMA6D also inhibited axonal extension in a nerve growth factor (NGF; see 162030)-differentiated rat pheochromocytoma cell line.
