Sequence 1114(cSema6D)

From Wikisequences
Jump to: navigation, search
Sequence cSema6D
Target SEMA6D ( Gallus gallus )
Description Sema domain, transmembrane domain ( TM ), and cytoplasmic domain, ( semaphorin ) 6D

Ensembl: ENSG00000137872 UniGene: Hs.511265 EntrezGene: 80031 Ensembl Chr15: 45797978 - 45853709 Strand: 1 GO terms: 0004866 0004872 0005737 0007275 0007399 0016020 0016021 0030154

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) GCAGGAAATTAACATGGAGTT / siRNA antisense (21b) CTCCATGTTAATTTCCTGCTT
Application gene silencing
Name cSema6D

References

Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling.Toyofuku T, Zhang H, Kumanogoh A, Takegahara N, Yabuki M, Harada K, Hori M, Kikutani H.Nat Cell Biol. 2004 Dec;6(12) :1204-11. Epub 2004 Nov 14. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Gene Function. Qu et al. (2002) exposed chicken embryo dorsal root ganglion explants and neonatal rat cortical and hippocampal neurons to SEMA6D secreted from transfected COS-7 cells and found that SEMA6D induced growth cone collapse. SEMA6D also inhibited axonal extension in a nerve growth factor (NGF; see 162030)-differentiated rat pheochromocytoma cell line.

Support Doctors Without Borders