Sequence 1115(SETDB1-1 , SETDB11)

From Wikisequences
Jump to: navigation, search
Sequence SETDB1-1 , SETDB11
Target SETDB1 ( Homo sapiens )
Description SET domain, bifurcated 1

Ensembl: ENSG00000133321 UniGene: Hs.643565 EntrezGene: 9869 Ensembl Chr11: 63060856 - 63070505 Strand: 1 GO terms: 8285

Design shRNA
Chemistry RNA
Sequence (47b) GTTCGGCTACAGCTATTCATTCAAGAGATGAATAGCTGTAGCCGAAC
Application gene silencing
Name SETDB1-1 , SETDB11

References

mAM facilitates conversion by ESET of dimethyl to trimethyl lysine 9 of histone H3 to cause transcriptional repression.Wang H, An W, Cao R, Xia L, Erdjument-Bromage H, Chatton B, Tempst P, Roeder RG, Zhang Y.Mol Cell. 2003 Aug;12(2) :475-87.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders