Sequence 1116(hAM-1 , hAM1)
From Wikisequences
Sequence hAM-1 , hAM1 | |
---|---|
Target | SETDB1 ( Homo sapiens ) |
Description | SET domain, bifurcated 1
Ensembl: ENSG00000133321 UniGene: Hs.643565 EntrezGene: 9869 Ensembl Chr11: 63060856 - 63070505 Strand: 1 GO terms: 8286 |
Design | shRNA |
Chemistry | RNA |
Sequence | (47b) CATCTCTCCTTCCAATCGATTCAAGAGATCGATTGGAAGGAGAGATG |
Application | gene silencing |
Name | hAM-1 , hAM1 |
References
mAM facilitates conversion by ESET of dimethyl to trimethyl lysine 9 of histone H3 to cause transcriptional repression.Wang H, An W, Cao R, Xia L, Erdjument-Bromage H, Chatton B, Tempst P, Roeder RG, Zhang Y.Mol Cell. 2003 Aug;12(2) :475-87.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478