Sequence 1121(Sgo1 1 , Sgo11)

From Wikisequences
Jump to: navigation, search
Sequence Sgo1_1 , Sgo11
Target SGOL1 ( Homo sapiens )
Description Shugoshin-like 1 ( S. pombe )

Ensembl: ENSG00000129810 UniGene: Hs.105153 EntrezGene: 151648 Ensembl Chr3: 20177091 - 20202687 Strand: -1 GO terms: 0000775 0005515 0005529 0005634 0007049 0007067 0045132 0051301

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) CCTGCTCAGAACCAGGAAATT / siRNA antisense (21b) TTTCCTGGTTCTGAGCAGGTT
Application gene silencing
Name Sgo1_1 , Sgo11

References

Human Bub1 protects centromeric sister-chromatid cohesion through Shugoshin during mitosis.Tang Z, Sun Y, Harley SE, Zou H, Yu H.Proc Natl Acad Sci U S A. 2004 Dec 28;101(52) :18012-7. Epub 2004 Dec 16. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders