Sequence 1123(cont)

From Wikisequences
Jump to: navigation, search
Sequence cont
Target Sirpa ( Mus musculus )
Description Signal-regulatory protein alpha

Ensembl: ENSMUSG00000037902 UniGene: Mm.1682 EntrezGene: 19261 Ensembl Chr2: 129418650 - 129457964 Strand: 1 GO terms: 0004872 0005515 0005615 0005887 0006910 0006911 0006928 0007010 0007015 0007160 0016020 0045309 0050766

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) TCATAGACAAGAGGCAGAGTT / siRNA antisense (21b) CTCTGCCTCTTGTCTATGATT
Application gene silencing
Name cont

References

Inhibition of xenogeneic response in porcine endothelium using RNA interference.Zhu M, Wang SS, Xia ZX, Cao RH, Chen D, Huang YB, Liu B, Chen ZK, Chen S.Transplantation. 2005 Feb 15;79(3) :289-96. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders