Sequence 1123(cont)
From Wikisequences
Sequence cont | |
---|---|
Target | Sirpa ( Mus musculus ) |
Description | Signal-regulatory protein alpha
Ensembl: ENSMUSG00000037902 UniGene: Mm.1682 EntrezGene: 19261 Ensembl Chr2: 129418650 - 129457964 Strand: 1 GO terms: 0004872 0005515 0005615 0005887 0006910 0006911 0006928 0007010 0007015 0007160 0016020 0045309 0050766 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TCATAGACAAGAGGCAGAGTT / siRNA antisense (21b) CTCTGCCTCTTGTCTATGATT |
Application | gene silencing |
Name | cont |
References
Inhibition of xenogeneic response in porcine endothelium using RNA interference.Zhu M, Wang SS, Xia ZX, Cao RH, Chen D, Huang YB, Liu B, Chen ZK, Chen S.Transplantation. 2005 Feb 15;79(3) :289-96.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
