Sequence 1124(mSHPS-1 , mSHPS1)
From Wikisequences
Sequence mSHPS-1 , mSHPS1 | |
---|---|
Target | Sirpa ( Mus musculus ) |
Description | Signal-regulatory protein alpha
Ensembl: ENSMUSG00000037902 UniGene: Mm.1682 EntrezGene: 19261 Ensembl Chr2: 129418650 - 129457964 Strand: 1 GO terms: 0004872 0005515 0005615 0005887 0006910 0006911 0006928 0007010 0007015 0007160 0016020 0045309 0050766 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGTGACTCAGCCTGAGAAATT / siRNA antisense (21b) TTTCTCAGGCTGAGTCACCTT |
Application | gene silencing |
Name | mSHPS-1 , mSHPS1 |
References
Negative regulation of phagocytosis in macrophages by the CD47-SHPS-1 system.Okazawa H, Motegi S, Ohyama N, Ohnishi H, Tomizawa T, Kaneko Y, Oldenborg PA, Ishikawa O, Matozaki T.J Immunol. 2005 Feb 15;174(4) :2004-11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478