Sequence 1125(S2)

From Wikisequences
Jump to: navigation, search
Sequence S2
Target SKP2 ( Homo sapiens )
Description S-phase kinase-associated protein 2 ( p45 )

Ensembl: ENSG00000145604 UniGene: Hs.23348 EntrezGene: 6502 Ensembl Chr5: 36187946 - 36219902 Strand: 1 GO terms: 0000074 0000082 0005515 0006512 0008283

Design shRNA
Chemistry RNA
Sequence (56b) CACCATCAGATCTCTCTACTTTATTCAAGAGATAAAGTAGAGAGATCTGATTTTTT
Application gene silencing
Name S2

References

Gene therapy for human small-cell lung carcinoma by inactivation of Skp-2 with virally mediated RNA interference.Sumimoto H, Yamagata S, Shimizu A, Miyoshi H, Mizuguchi H, Hayakawa T, Miyagishi M, Taira K, Kawakami Y.Gene Ther. 2005 Jan;12(1) :95-100. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders