Sequence 1125(S2)
From Wikisequences
| Sequence S2 | |
|---|---|
| Target | SKP2 ( Homo sapiens ) |
| Description | S-phase kinase-associated protein 2 ( p45 )
Ensembl: ENSG00000145604 UniGene: Hs.23348 EntrezGene: 6502 Ensembl Chr5: 36187946 - 36219902 Strand: 1 GO terms: 0000074 0000082 0005515 0006512 0008283 |
| Design | shRNA |
| Chemistry | RNA |
| Sequence | (56b) CACCATCAGATCTCTCTACTTTATTCAAGAGATAAAGTAGAGAGATCTGATTTTTT |
| Application | gene silencing |
| Name | S2 |
References
Gene therapy for human small-cell lung carcinoma by inactivation of Skp-2 with virally mediated RNA interference.Sumimoto H, Yamagata S, Shimizu A, Miyoshi H, Mizuguchi H, Hayakawa T, Miyagishi M, Taira K, Kawakami Y.Gene Ther. 2005 Jan;12(1) :95-100.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
