Sequence 1128(siCD98-1 , siCD981)

Sequence siCD98-1 , siCD981
Target	SLC3A2 ( Homo sapiens )
Description	Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Ensembl: ENSG00000168003 UniGene: Hs.502769 EntrezGene: 6520 Ensembl Chr11: 62380094 - 62412928 Strand: 1 GO terms: 0003824 0005432 0005515 0005975 0006810 0006816 0006865 0009986 0015171 0015827 0016020 0016021 0016049 0043169
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TCTGAAGGATGCATCCTCATT / siRNA antisense (21b) TGAGGATGCATCCTTCAGATT
Application	gene silencing
Name	siCD98-1 , siCD981

References

RNA interference-induced reduction in CD98 expression suppresses cell fusion during syncytialization of human placental BeWo cells.Kudo Y, Boyd CA.FEBS Lett. 2004 Nov 19;577(3) :473-7.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Posillico et al. (1985) demonstrated that the cell surface protein identified by 4F2 modulates intracellular calcium. It is a heteromeric glycoprotein with unique tissue distribution including activated T cells, neuroendocrine cells, and all malignant cell lines. Michalak et al. (1986) showed that both the 44D7 and the 4F2 monoclonal antibodies inhibit specifically the sodium-dependent calcium fluxes characteristic of Na+/Ca(2+) exchanges of cardiac and skeletal muscle.

Animal Model. Feral et al. (2005) found that Cd98hc null mouse cells were defective in integrin-dependent cell spreading and cell migration, and they showed increased sensitivity to anchorage deprivation-induced apoptosis. Furthermore, Cd98hc was required for efficient adhesion-induced activation of Akt (see 164730) and Rac (see 602048) GTPase. Cd98 promotes amino acid transport through its light chains; however, a Cd98hc mutant that could interact with beta-1 integrin (135630) but not with light chains restored integrin-dependent signaling and protection from apoptosis. In addition, Cd98hc null embryonic stem cells lost their tumorigenic potential in vivo.

Using cell culture and mice with deletion of Cd98hc in smooth muscle cells, Fogelstrand et al. (2009) showed that Cd98hc is markedly upregulated in neointimal and cultured vascular smooth muscle cells, and that activated, but not quiescent, vascular smooth muscle cells require Cd98hc for survival. In vivo, lack of Cd98hc does not affect normal vessel morphology but does reduce intimal hyperplasia after arterial injury. In vitro, loss of Cd98hc suppresses proliferation and induces apoptosis of vascular smooth muscle cells. Fogelstrand et al. (2009) concluded that CD98hc is important for vascular smooth muscle cell proliferation and survival and that activated vascular smooth muscle cells are physiologically dependent on CD98hc, indicating that CD98hc may be a therapeutic target for vasoocclusive disorders.

By specifically deleting Cd98 in mouse T cells, Cantor et al. (2011) prevented experimental autoimmune diabetes and reduced T-cell clonal expansion without impairing T-cell homing to pancreatic islets. Unlike Cd98 deletion in B lymphocytes, Cd98-null T cells showed only modestly impaired antigen-driven and homeostatic proliferation. Cd98-null T cells were activated by antigen, produced cytokines, and mediated efficient cell-mediated target cell lysis. Mutation analysis and generation of recombinant Cd98 showed that T-cell clonal expansion required the Cd98 integrin-binding domain. T cells bearing a Cd98 integrin-binding domain and expanded in vitro could adoptively transfer diabetes. Cantor et al. (2011) concluded that clonal expansion and the integrin-binding domain of CD98 are required for the pathogenesis of autoimmune disease.

Quackenbush et al. (1987) reviewed the evidence pointing to a role of the 4F2 molecule in the regulation of intracellular calcium concentration and the concomitant control of growth, excitability, and endocrine secretion.

Amino acid transport across cellular plasma membranes depends on several parallel-functioning transporters and exchangers. The widespread transport system L accounts for a sodium-independent exchange of large neutral amino acids, whereas the system y(+)L exchanges positively charged amino acids and/or neutral amino acids together with sodium. The 4F2 heavy chain alone facilitates amino acid transport through both the L-type and the y(+)L-type systems, depending on the cellular system. Mastroberardino et al. (1998) identified the permease-related protein E16 (600182) as the first light chain of the 4F2 heavy chain and showed that the resulting heterodimeric complex mediates L-type amino acid transport. They hypothesized that at least one other related light chain may associate with the 4F2 heavy chain to produce a heterodimeric transporter with y(+)L transport characteristics.

The MDU1 gene is associated with endocrine cell function including that of pancreatic islet cells, thyroid C cells, and parathyroid cells (Posillico et al., 1987). Antibodies to the MDU1 cell surface glycoprotein modulate intracellular calcium and can stimulate parathyroid hormone secretion.